modified closed-end dna (cedna)

专利摘要:
CeDNA vectors with linear and continuous structure can be produced in high yields and used for effective transfer and expression of a transgene. The ceDNA vectors comprise an expression cassette and two different ITR sequences derived from AAV genomes in a specified order. Some ceDNA vectors provided here also comprise cis regulatory elements and provide high efficiency of gene expression. Also provided here are methods and cell lines for reliable and efficient production of linear, continuous and capsid-free DNA vectors.
公开号:BR112020004151A2
申请号:R112020004151-3
申请日:2018-09-07
公开日:2020-09-08
发明作者:Robert Michael Kotin；Ozan Alkan；Annaliese Jones；Douglas Anthony Kerr；Ara Karl Malakian；Matthew John Simmons；Teresa L. Wright
申请人:Generation Bio Co.；
IPC主号:

专利说明:

[001] [001] This claim claims benefit under 35 USC § 119 (e) of the US Provisional Order Numbers: 62 / 556,319; 62 / 556,324; 62 / 556,329; 62 / 556,331; 62 / 556,281 and 62 / 556,335, each of which was deposited on September 8, 2017, the content of each is incorporated here for reference in its entirety. SEQUENCE LISTING
[002] [002] The present application contains a Sequence Listing that was submitted electronically in ASCII format and is incorporated by reference in its entirety. Said ASCII copy, created on September 7, 2018, is called 080170-090580WOPT_SL.txt and is 205,991 bytes in size. TECHNICAL FIELD
[003] [003] The present invention relates to the field of gene therapy, including the delivery of exogenous DNA sequences to a cell target, tissue, organ or organism. BACKGROUND
[004] [004] Gene therapy aims to improve the clinical results of patients suffering from genetic mutations or acquired diseases caused by an aberration in the gene expression profile. Gene therapy includes the treatment or prevention of medical conditions resulting from defective genes or abnormal regulation or expression, for example, under-expression or over-expression, which can result in a disorder, disease, malignancy, etc. For example, a disease or disorder caused by a defective gene can be treated, prevented or improved by delivering corrective genetic material to a patient, resulting in the therapeutic expression of the genetic material within the patient. The basis of gene therapy is to provide a transcription cassette with an active gene product (sometimes called a transgene), for example, which can result in a positive effect of gaining function, a negative effect of loss of function or other effect. result, such as an oncolytic effect. Gene therapy can also be used to treat a disease or malignancy caused by other factors. Human monogenic disorders can be treated by the delivery and expression of a normal gene in target cells. The delivery and expression of a corrective gene in the patient's target cells can be accomplished by several methods, including the use of manipulated viruses and viral gene delivery vectors. Among the many virus-derived vectors available (for example, recombinant retrovirus, recombinant lentivirus, recombinant adenovirus, and the like), recombinant adeno-associated virus (rAAV) is gaining popularity as a versatile vector in gene therapy.
[005] [005] Adenoassociated viruses (AAV) belong to the parvoviridae family and, more specifically, constitute the genus parovoviridae. The AAV genome is composed of a single-stranded linear DNA molecule that contains approximately 4.7 kilobases (kb) and consists of two large open reading frames (ORFs) encoding Rep (replication) and Non-structural cap (capsid). A second ORF was identified within the cap gene that encodes the set activation protein (AAP). The DNAs that flank the AAV coding regions are two cis-inverted terminal repeat (ITR) sequences, approximately 145 nucleotides in length, with interrupted palindromic sequences that can be folded into energized hairpin structures. stable cells that function as DNA replication primers. In addition to their role in DNA replication, ITR sequences have been shown to be involved in integrating viral DNA into the cell genome, rescuing the host genome or plasmid, and encapsulating
[006] [006] Vectors derived from AAV (ie, AAV vectors matching (rAVV) or AAV) are attractive for the delivery of genetic material due to the fact that (i) they are capable of infecting (transducing) a wide variety of cell types that do not divide and divide, including myocytes and neurons; (ii) they are devoid of the structural genes of the virus, thus decreasing the responses of host cells to infection by the virus, for example, responses mediated by interferon; (iii) wild type viruses are considered non-pathological in humans; (iv) in contrast to wild-type AAV, with the ability to integrate into the host cell genome, AAV vectors with replication deficiency do not have the rep gene and generally persist as episomes, thus limiting the risk insertion mutagenesis or genotoxicity; and (v) in comparison to other vector systems, AAV vectors are generally considered to be relatively poor immunogens and therefore do not trigger a significant immune response (see ii), thus gaining the persistence of the vector's DNA and potentially the long-term expression of therapeutic transgenes. AAV vectors can also be produced and formulated with a high titer and administered through intra-arterial, intravenous or intraperitoneal injections, allowing the distribution of the vector and the transfer of genes to significant muscle regions through a single injection in rodents (Goyenvalle et al., 2004; Fougerousse et al., 2007; Koppanati et al., 2010; Wang et al., 2009) and dogs. In a clinical study to treat spinal muscular dystrophy type 1, AAV vectors were administered systematically with the intention of reaching the brain, resulting in apparent clinical improvements.
[007] [007] However, there are several important deficiencies in the use of AAV particles as a gene delivery vector. A major disadvantage associated with rAAV is its limited viral packing capacity of about 4.5kb of heterologous DNA (Dong et al., 1996; Athanasopoulos et al., 2004; Lai et al., 2010). As a result, the use of AAV vectors was limited to less than 150,000 Da of the protein's coding capacity. The second disadvantage is that, as a result of the prevalence of wild-type AAV infection in the population, candidates for gene therapy with rAAV should be screened for the presence of neutralizing antibodies that eliminate the patient's vector. A third disadvantage is related to the immunogenicity of the capsid, which prevents readministration in patients who were not excluded from an initial treatment. The patient's immune system can respond to the vector, which effectively acts as a "booster" injection to stimulate the immune system, generating highly titrated anti-AV antibodies that prevent future treatments. Some recent reports indicate concerns about immunogenicity in high-dose situations. Another notable disadvantage is that the onset of AAV-mediated gene expression is relatively slow, since single-stranded AAV DNA must be converted to double-stranded DNA before heterologous gene expression. Although attempts have been made to circumvent this problem by constructing double-stranded DNA vectors, this strategy further limits the size of the transgene expression cassette that can be integrated into the AAV vector (McCarty, 2008; Varenika et al., 2009; Foust et al., 2009).
[008] [008] In addition, conventional AAV virions with capsids are produced by introducing a plasmid or plasmids containing the AAV genome, rep genes and caps genes (Grimm et al., 1998). After the introduction of these helper plasmids in trans, the AAV genome is "rescued" (that is, released and later
[009] [009] Consequently, the use of adenoassociated virus vectors (AAV) for gene therapy is limited due to the single administration to patients (due to the patient's immune response), the limited range of transgenic genetic material suitable for delivery in AAV vectors due to the minimal viral packaging capacity (about 4.5kb) of the associated AAV capsid, as well as the slow AAV-mediated gene expression. Orders for clinical gene therapies for rAAV are further burdened by patient-to-patient variability not predicted by dose response in single-mouse models or other model species.
[0010] [0010] Recombinant AAV vectors without capsid can be obtained as an isolated linear nucleic acid molecule comprising expressable transgenic and promoter regions, flanked by two wild-type AAV inverted terminal repeat sequences (ITRs) binding sites and terminal resolution. These recombinant AAV vectors are devoid of AAV capsid protein coding sequences and may be single-stranded, double-stranded or duplexed with one or both ends covalently linked through the two ITR-type palindrome sequences. wild-type (e.g. WO2012 / 123430, US Patent No. 9,598,703). They avoid many of the problems of gene therapy mediated by AAV, because the capacity of the transgene is much greater, the onset of expression of the transgene is fast and the patient's immune system recognizes the DNA molecules as a virus to be eliminated. However, constant expression of a transgene may not be desirable in all cases, and canonical AAV wild-type canon ITRs may not be optimized for ceDNA function. Therefore, there remains an important unmet need for controllable recombinant DNA vectors with better production and / or expression properties. BRIEF DESCRIPTION OF THE INVENTION
[0011] [0011] The invention described here is a non-viral DNA vector without capsid with covalently closed ends (referred to here as "closed end DNA vector" or "ceDNA vector"). The ceDNA vectors described here are linear and capsid-free duplex DNA molecules, formed from a continuous strand of complementary DNA with covalently closed ends (linear, continuous and non-encapsulated structure), comprising a 5 'repeat sequence inverted terminal (ITR) and a sequence of 3 'ITR that is different or asymmetric to each other.
[0012] [0012] The technology described here refers to a ceDNA vector containing at least one modified AAV inverted terminal repeat (ITR) sequence and an expressable transgene. The ceDNA vectors described here can be produced in eukaryotic cells, devoid of modifications in prokaryotic DNA and bacterial contamination by endotoxin in insect cells.
[0013] [0013] In one aspect, non-viral DNA vectors without capsid with covalently closed ends are preferably linear duplex molecules and are obtained from a polynucleotide vector that encodes a heterologous nucleic acid operably positioned between two different inverted terminal repeat sequences (ITRs) (for example, AAV IAVs), where at least one of the ITRs comprises a terminal resolution site and a replication protein binding site (RPS) (sometimes called replicative protein binding site), for example, a protein binding site
[0014] [0014] In some embodiments, the ceDNA vector comprises: (1) an expression cassette comprising a cis regulatory element, a promoter and at least one transgene; or (2) a promoter operatively linked to at least one transgene and (3) two self-complementary sequences, for example, ITRs, flanking said expression cell, in which the ceDNA vector is not associated with a capsid protein. In some embodiments, the ceD-NA vector comprises two self-complementary sequences found in an AAV genome, at least one of which comprises an operational Rep (RBE) linker (also sometimes referred to here as "RBS") and one terminal resolution site (three) of the AAV or a functional variant of the RBE and one or more cis regulatory elements operatively linked to a transgene. In some embodiments, the ceDNA vector comprises additional components to regulate the expression of the transgene, for example, regulatory switches, described here in the section entitled "Regulatory keys" to control and regulate the expression of the transgene, and may include a regulatory co-mutator, for example, an extermination switch to allow controlled cell death of a cell comprising a ceDNA vector.
[0015] [0015] In some modalities, the two self-combining sequences
[0016] [0016] Exemplary ITR sequences for use in the ceDNA vectors are revealed in any one or more of Tables 2-10A and 10B, or SEQ ID NO: 2, 52, 101-499 and 545-547 or in the partial ITR sequences shown in Figure 26A-26B. In some embodiments, the ceDNA vectors do not have an ITR that comprises any selected sequence of SEQ ID NO: 500-529.
[0017] [0017] In some modalities, a ceDNA vector can comprise an ITR with a modification in the ITR corresponding to any of the modifications in the ITR sequences or partial ITR sequences shown in any one or more of Tables 2, 3, 4, 5, 6, 7, 8, 9, 10A and 10B herein.
[0018] [0018] As an example example, the present description provides a closed-ended DNA vector comprising a promoter operably linked to a transgene, in which the ceDNA is devoid of capsid proteins and is: (a) produced at from a ceDNA plasmid (for example, see Examples 1-2 and / or Figures 1A-B) encoding a right side AAV2 ITR mutated with the same number of duplex base pairs intramolecularly as SEQ ID NO: 2 or a left side AAV2 IAV muted with the same number of duplex base pairs intramolecularly as SEQ ID NO: 51 in its secondary hairpin configuration (preferably excluding the deletion of any AAA or TTT terminal loop in this configuration compared to those reference sequences) and (b) is identified as ceDNA using the assay for the identification of ceDNA by agarose gel electrophoresis under native denaturation and gel conditions in Example 1. Examples of these sequences Modified ITR s are provided in Tables 2, 3, 4, 5, 6, 7, 8, 9, 10A and 10B.
[0019] [0019] The technology described here also refers to a ceDNA vector that can deliver and encode one or more transgenes in a target cell, for example, in which the ceDNA vector comprises a multicistronic sequence or where the transgene and its context native genomics (eg, transgene, introns and endogenous untranslated regions) are incorporated together into the ceDNA vector. Transgenes can be protein-encoding transcripts, non-coding transcripts, or both. The ceDNA vector can comprise several coding sequences and a non-canonical translation start site or more than one promoter to express protein coding transcripts, non-coding transcripts or both. The transgene may comprise a sequence that encodes more than one protein or it may be a sequence from a non-coding transcript. The expression cassette can comprise, for example, more than 4,000 nucleotides, 5,000 nucleotides, 10,000 nucleotides or 20,000 nucleotides.
[0020] [0020] The expression cassette can also comprise an internal ribosome entry site (IRES) and / or an element 2A. Cis regulatory elements include, without limitation, a promoter, a ribosome switch, an isolator, a mir-adjustable element, a post-transcriptional regulatory element, a tissue and cell type specific promoter and an enhancer. In some modalities, ITR can act as the promoter of the transgene. In some modalities, the ceDNA vector comprises additional components to regulate the expression of the transgene. For example, the additional regulatory component can be a regulatory switch, as described in this document, including, but not limited to, a kill switch, which can kill the cell infected with ceDNA, if necessary, and other elements inducible and / or repressible.
[0021] [0021] The technology described in this document also provides new methods of delivery and efficient and selective expression of one or more transgenes using the ceDNA vectors. A ceDNA vector is able to be absorbed by host cells, as well as transported to the nucleus in the absence of the AAV capsid. In addition, the ceDNA vectors described here do not have a capsid and therefore prevent the immune response that can arise in response to vectors containing the capsid.
[0022] [0022] Aspects of the invention refer to methods for producing the ceDNA vectors described herein. Other modalities refer to a vector of ceDNA produced by the method provided here. In one embodiment, the non-viral DNA vector without capsid (ceDNA vector) is obtained from a plasmid (referred to herein as "ceDNA plasmid") that comprises a polynucleotide expression construct model that comprises in that order: a first 5 'inverted terminal repeat (for example, AAV ITR); an expression cassette; and a 3 'ITR (for example, AAV ITR), where at least one out of 5' and 3 'ITR is a modified ITR or when the 5' and 3 'ITRs are modified, they have different modifications between themselves and are not the same sequence.
[0023] [0023] The ceDNA vector described in this document is obtained by various means that would be known to the person skilled in the art after reading this description. For example, a polynucleotide expression construct model used to generate the ceDNA vectors of the present invention can be a ceDNA plasmid (for example, see Table 12 or Figure 10B), a ceDNA-bacmid and / or a ceDNA -baculovirus. In one embodiment, the ceDNA plasmid comprises a restriction cloning site (for example, SEQ ID NO: 7) operably positioned between the ITRs where an expression cassette comprising, for example, a promoter operably linked to a transgene , for example, a reporter gene and / or a therapeutic gene can be inserted. In some embodiments, the ceDNA vectors are produced from a polynucleotide model (for example, ceDNA plasmid, ceDNA-bacmid, ceDNA-baculovirus) containing a modified ITR compared to the AAV3 ITR sequence or corresponding flanking AAV2 ITR, where the modification is any one or more among deletion, insertion and / or substitution.
[0024] [0024] In a permissive host cell, in the presence of, for example, Rep, the polynucleotide model that has at least one modified ITR replicates to produce ceDNA vectors. The production of the ceDNA vector passes through two stages: first, excision ("rescue") of the model of the main structure model (for example, cDNA plasmid, ceDNA-bacmid, ceDNA-baculovirus genome, etc.) of Rep proteins and second Rep-mediated replication of excised ceDNA vector. The Rep proteins and the Rep binding sites of the various AAV serotypes are well known to those skilled in the art. One person skilled in the art understands choosing a Rep protein from a syndrome that binds and replicates the nucleic acid sequence based on at least one functional ITR. For example, if the competent ITR for replication is AAV serotype 2, the corresponding representative would be an AAV serotype that works with that serotype, such as AAV2 ITR with AAV2 or AAV4 Rep, but not AAV5 Rep, which doesn't happen. After replication, the covalently closed ceDNA vector continues to accumulate in permissive cells and the ceDNA vector is preferably sufficiently stable over time in the presence of Rep protein under standard conditions of replication, for example. For example, to accumulate in an amount that is at least 1 pg / cell, preferably at least 2 pg / cell, preferably at least 3 pg / cell, more preferably at least 4 pg / cell, even more preferably at least 5 pg /cell.
[0025] [0025] Therefore, an aspect of the invention relates to a process that comprises the steps of: a) incubating a population of host cells (for example, insect cells) that harbor the polynucleotide expression construct model (for example , a plasmid of ceDNA, a ceDNA-bacmid, and / or a ceDNA-baculovirus), which is devoid of coding sequences of the viral capsid, in the presence of a Rep protein under effective conditions and for a sufficient time to induce production the vector of ceDNA in host cells and where the host cells do not comprise sequences coding for the viral capsid; and b) harvesting and isolating the ceDNA vector from host cells. The presence of the Rep protein induces the replication of the vector polynucleotide with a modified ITR to produce the ceDNA vector in a host cell. However, viral particles (for example, AAV virions) are not expressed. Thus, there is no forced size limitation per virion.
[0026] [0026] The presence of the isolated ceDNA vector from the host cells can be confirmed by digesting the isolated DNA from the host cell with a restriction enzyme with a single recognition site in the ceDNA vector and analyzing the DNA material digested in denaturation and non-denaturation gels to confirm the presence of characteristic bands of linear and continuous DNA compared to linear and non-continuous DNA.
[0027] [0027] In some modalities, this request can be defined in any of the following paragraphs:
[0028] [0028] In some modalities, an aspect of the technology described in this document concerns a non-viral DNA vector without capsid with covalently closed ends (ceDNA vector), in which the ceDNA vector comprises at least one heterologous nucleotide sequence, operably positioned between asymmetric inverted terminal repeat sequences (asymmetric ITRs), in which at least one of the asymmetric ITRs comprises a functional terminal resolution site and a Rep binding site, and optionally the sequence of heterologous nucleic acids co-complicates for a transgene, and where the vector is not in a viral capsid.
[0029] [0029] These and other aspects of the invention are described in more detail below. DESCRIPTION OF THE DRAWINGS
[0030] [0030] Figure 1A illustrates an exemplary structure of a ceDNA vector. In this embodiment, the exemplifying ceDNA vector comprises an expression cassette containing the CAG, WPRE and BGHpA promoter. An open reading frame (ORF) encoding a luciferase transgene is inserted at the cloning site (R3 / R4) between the CAG promoter and the WPRE. The expression cassette is flanked by two inverted terminal repeats (ITRs) - the wild type AAV2 ATR upstream (5'-end) and the modified ITR downstream (3'-end) of the expression cassette; therefore, the two ITRs that flank the expression cassette are asymmetric to each other.
[0031] [0031] Figure 1B illustrates an exemplary structure of a ceDNA vector with an expression cassette containing the CAG, WPRE and BGHpA promoter. An open reading frame (ORF) encoding the Luciferase transgene is inserted at the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two inverted terminal repeats (ITRs) - a modified upstream ITR (5'-end) and a wild type ITR downstream (3'-end) of the expression cassette.
[0032] [0032] Figure 1C illustrates an exemplary structure of a ceDNA vector with an expression cassette containing an enhancer / promoter, an open reading frame (ORF) for inserting a transgene, a post-transcriptional element (WPRE) and a polyA signal. An open reading frame (ORF) allows the insertion of a transgene at the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two inverted terminal repetitions (ITRs) that are asymmetrical to each other; a modified upstream ITR (5'-end) and a modified downstream ITR (3 'end) of the expression cassette, where the 5' ITR and 3 'ITR are both modified ITRs, but have modifications different (that is, they do not have the same modifications).
[0033] [0033] Figure 2A provides the T-rod-handle structure of an AAV2 wild-type left ITR (SEQ ID NO: 538) with the identification of arm A-A ', arm B-B', arm C -C ', two sites connecting to Rep (RBE and RBE') and also shows the terminal resolution site (trs). The RBE contains a series of 4 duplex tetramers that are believed to interact with Rep 78 or Rep 68. In addition, the RBE 'is also believed to interact with the Rep complex mounted on the wild type or ITR mutated in construction. The D and D 'regions contain binding sites for the transcription factor and other conserved structure. Figure 2B shows Rep-catalyzed cutting and binding activities proposed in a left wild type ITR (SEQ ID
[0034] [0034] Figure 3A provides the primary structure (polynucleotide sequence) (left) and the secondary structure (right) of the RBE-containing portions of arm A-A 'and arm C-C' and B-B 'of type left wild-type AAV2 ITR (SEQ ID NO: 540). Figure 3B shows an exemplary mutated ITR sequence (also referred to as a modified ITR) for the left ITR. The primary structure (left) and the predicted secondary structure (right) of the RBE portion of arm A-A ', arm C and arm B-B' of an example mutated left ITR (ITR-1, left) are shown ) (SEQ ID NO: 113). Figure 3C shows the primary structure (left) and the secondary structure (right) of the RBE-containing portion of the A-A 'loop and the B-B' and C-C 'arms of the wild-type right AAV2 ITR (SEQ) ID NO: 541). Figure 3D shows a modified ITR on the example right. The primary (left) and predicted secondary (right) structure of the RBE portion of arm A-A ', B-B' and arm C of an example of an exemplary mutant right ITR (ITR-1, right) (SEQ ID NO: 114). Any combination of left and right ITR (for example, AAV2 ITRs or other viral serotype or synthetic ITR) can be used, as long as the left ITR is asymmetric or different from the right ITR. Each of Figures 3A-3D shows polynucleotide sequences that refer to the sequence used in the plasmid or bacmid / baculovirus genome used to produce the ceDNA as described herein. Also included in each of Figures 3A-3D are corresponding secondary ceDNA structures inferred from the configurations of the ceDNA vector in the plasmid or bacmid / baculovirus genome and the predicted Gibbs free energy values.
[0035] [0035] Figure 4A is a schematic illustrating an upstream process for producing baculovirus-infected insect cells (BIICs) that are useful in the production of ceDNA in the process described in the scheme in Figure 4B. Figure 4B is a schematic of an exemplary method of ceDNA production and Figure 4C illustrates a biochemical method and process to confirm the production of the ceDNA vector. Figures 4D and 4E are schematic illustrations that describe a process for identifying the presence of ceDNA in the DNA collected from cell pellets obtained during the production processes of ceD-NA in Figure 4B. Figure 4E shows DNA that has a non-continuous structure. The ceDNA can be cut by a restriction endonuclease, which has a single recognition site in the ceDNA vector, and generate two DNA fragments with different sizes (1kb and 2kb) in neutral and denaturing conditions. Figure 4E also shows a ceDNA that has a linear and continuous structure. The ceDNA vector can be cut by the restriction endonuclease and generate two fragments of DNA that migrate as 1kb and 2kb in neutral conditions, but in denaturing conditions, the supports remain connected and produce unique strands that migrate like 2kb and 4kb. Figure 4D shows schematic bands expected for an exemplary ceDNA left uncut or digested with a restriction endonuclease and then electrophoresed in a native gel or denaturing gel. The leftmost scheme is a native gel and shows several bands suggesting that, in its duplex and uncut form, ceDNA exists in at least monomeric and dimeric states, visible as a smaller monomer of faster migration and a dimer of slower migration with twice the size of the monomer. The second scheme on the left shows that when the ceDNA is cut with a restriction endonuclease, the original bands disappear and the faster migration bands (for example, smaller ones) appear, corresponding to the fragment sizes expected after cleavage. Under denaturing conditions, the original duplex DNA is single stranded and migrates as a species twice as large as that observed in the native gel, due to the fact that the complementary strands are covalently linked. Thus, in the second scheme on the right, the digested ceDNA shows a distribution of bands similar to that observed in the native gel, but the bands migrate as fragments twice the size of their native gel equivalents. The scheme on the right shows that the uncut ceDNA in conditions of denaturation migrates as an open circle of single stripe and, therefore, the bands observed are twice the size of those observed in native conditions where the circle is not open. In this figure, "kb" is used to indicate the relative size of the nucleotide molecules based, depending on the context, on the length of the nucleotide chain (for example, for single-stranded molecules observed under denaturation conditions) or on number of base pairs (for example, for double-stranded molecules observed under native conditions).
[0036] [0036] Figure 5 is an example image of a denaturing gel running examples of ceDNA vectors with (+) or without (-) digestion with endonucleases (EcoRI for ceDNA 1 and 2 constructs; BamH1 for ceDNA 3 constructs and 4; SpeI for cDNA constructs 5 and 6 and XhoI for cDNA construction 7 and 8). The sizes of the bands highlighted with an asterisk were determined and provided at the bottom of the image.
[0037] [0037] Figure 6A shows results of an in vitro protein expression assay measuring luciferase activity (y-axis, RQ (Luc)) in HEK293 cells 48 hours after 400 ng transfection (black),
[0038] [0038] Figure 7A shows the viability of HEK293 cells (y-axis) 48 hours after the transfection of 400 ng (black), 200 ng (gray), or 100 ng (white) of the constructs identified on the x-axis (construct-1 , construct-3, construct-5, construct-7). Figure 7B shows the viability of HEK293 cells (y-axis) 48 hours after the transfection of 400 ng (black), 200 ng (gray), or 100 ng (white) of the constructs identified on the x-axis (construct-2, construct- 4, construct-6, construct-8).
[0039] [0039] Figure 8A is an exemplary Rep-bacmid in the plasmid pFBDLSR which comprises the nucleic acid sequences for the Rep Rep52 and Rep78 proteins. This example of Rep-bacmide comprises: IE1 promoter fragment (SEQ ID NO: 66); nucleotide sequence Rep78, including the Kozak sequence (SEQ ID NO: 67), polyhedron promoter sequence for the nucleotide sequence Rep52 (SEQ ID NO: 68) and Rep58, starting with the sequence Kozak gccgccacc) (SEQ ID NO: 69 ). Figure 8B is a schematic of an example ceDNA-1 plasmid, with the wt-L ITR promoter, CAG, luciferase transgene, WPRE and polyadenylation sequence and mod-R ITR.
[0040] [0040] Figure 9A shows the expected lower energy structure of the RBE-containing portion of the arm A-A 'and arm C-C' of an exemplary modified left ITR ("ITR-2 (left)" SEQ ID NO:
[0041] [0041] Figure 10A shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm B-B' of an exemplary modified left ITR ("ITR-3 (left)" SEQ ID NO: 103 ) and Figure 10B shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm B-B' of an exemplified modified right ITR ("ITR-3 (right)" SEQ ID NO: 104 ). They are expected to form a structure with a single arm (B-B ') and a single unpaired loop. Its unfolding Gibbs free energies are expected to be -74.8 kcal / mol.
[0042] [0042] Figure 11A shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm C-C' of an exemplary modified left ITR ("ITR-4 (left)" SEQ ID NO: 105) and Figure 11B shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm C-C' of an exemplified modified right ITR ("ITR-4 (right)" SEQ ID NO : 106). They are expected to form a structure with a single arm (C-C ') and a single unpaired loop. Its unfolding Gibbs free energies are expected to be -76.9 kcal / mol.
[0043] [0043] Figure 12A shows the expected lower energy structure of the RBE-containing portion of the A-A 'arm and the C-C' and B-B 'portions of an exemplary modified left ITR, showing a stacking of complementary bases from the C-B 'and C'-B portions ("ITR-10 (left)" SEQ ID NO: 107) and Figure 12B shows the lowest expected energy structure of the RBE-containing portion of arm A-A' and the portions B-B 'and C-C' of an exemplified modified right ITR, showing the complementary base pairing of the B-C 'and B'-C portions ("ITR-10 (right)" SEQ ID NO: 108). They are expected to form a structure with a single arm (a C'-B and C-B 'portion or a B'-C and B-C' portion) and a single unpaired loop. Its unfolding Gibbs free energies are expected to be -83.7 kcal / mol.
[0044] [0044] Figure 13A shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and the C-C' and B-B 'portions of an exemplary modified left ITR ("ITR-17 (left)" SEQ ID NO: 109) and Figure 13B shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and the C-C' and B-B 'portions of an exemplified modified right ITR ("ITR-17 (right) "SEQ ID NO: 110). ITR-17 (left) and ITR-17 (right) are expected to form a structure with a single arm (B-B ') and a single unpaired loop. Its Gibbs-free splitting energies are expected to be -73.3 kcal / mol.
[0045] [0045] Figure 14A shows the expected lower energy structure of the RBE-containing portion of the A-A 'arm of an exemplary modified ITR ("ITR-6 (left)" SEQ ID NO: 111) and Figure 14B mos - draws the expected lower energy structure of the RBE-containing portion of the A-A 'arm of an exemplary modified ITR ("ITR-6 (right)" SEQ ID NO: 112). ITR-6 (left) and ITR-6 (right) are expected to form a single arm structure. Its unfolding Gibbs-free energy is expected to be -54.4 kcal / mol.
[0046] [0046] Figure 15A shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm C and B-B' of an example of modified left ITR ("ITR-1 (left)" SEQ ID NO: 113) and Figure 15B shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm C and B-B' of an exemplified modified right ITR ("ITR-1 (right)" SEQ ID NO: 114).
[0047] [0047] Figure 16A shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm C' and B-B 'of an exemplified left modified ITR ("ITR-5 (left) "SEQ ID NO: 545) and Figure 16B shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm B-B' and C 'of an exemplified modified right ITR (" ITR-5 (right) "SEQ ID NO: 116). ITR-5 (left) and ITR-5 (right) are expected to form a structure with two arms, one of which (for example, the C 'arm) is truncated. Its unfolding Gibbs free energies are expected to be -73.4 kcal / mol.
[0048] [0048] Figure 17A shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm C-C' and B-B 'of an exemplified left modified ITR ("ITR-7 ( left) "SEQ ID NO: 117) and Figure 17B shows the lowest expected energy structure of the RBE-containing portion of arm A-A 'and arm B-B' and C-C 'of an exemplified modified right ITR ( "ITR-7 (right)" SEQ ID NO: 118). ITR-17 (left) and ITR-17 (right) are expected to form a structure with two arms, one of which (for example, arm B-B ') is truncated. Its unfolding Gibbs free energies are expected to be -89.6 kcal / mol.
[0049] [0049] Figure 18A shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm C-C' and B-B 'of an exemplified left modified ITR ("ITR-8 ( left) "SEQ ID NO: 119) and Figure 18B shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm B-B' and C-C 'of an exemplified modified right ITR ( "ITR-8 (right)" SEQ ID NO: 120). ITR-8 (left) and ITR-8 (right) are expected
[0050] [0050] Figure 19A shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm C-C' and B-B 'of an exemplified left modified ITR ("ITR-9 ( left) "SEQ ID NO: 121) and Figure 19B shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm B-B' and C-C 'of an exemplified modified ITR (" ITR-9 (right) "SEQ ID NO: 122). ITR-9 (left) and ITR-9 (right) are expected to form a structure with two arms, one of which is truncated. Its unfolding Gibbs free energies are expected to be -85.0 kcal / mol.
[0051] [0051] Figure 20A shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm C-C' and B-B 'of an exemplified modified left ITR ("ITR-11 (left)" SEQ ID NO: 123) and Figure 20B shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm B-B' and C-C 'of an exemplified modified right ITR ("ITR- 11 (right) "SEQ ID NO: 124). ITR-11 (left) and ITR-11 (right) are expected to form a structure with two arms, one of which is truncated. Its unfolding Gibbs free energies are expected to be - 89.5 kcal / mol.
[0052] [0052] Figure 21A shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm C-C' and arm B-B 'of an exemplified modified left ITR ("ITR-12 (left - da) "SEQ ID NO: 125) and Figure 21B shows the lowest expected energy structure of the RBE-containing portion of arm A-A 'and arm B-B' and C-C 'of an exemplified modified ITR ("ITR-12 (right)" SEQ ID NO: 126). Both ITR-12 (left) and ITR-12
[0053] [0053] Figure 22A shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm C-C' and arm B-B 'of an exemplary modified left ITR ("ITR-13 (left - da) "SEQ ID NO: 127) and Figure 22B shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm B-B' and C-C 'of an exemplified modified right ITR ("ITR-13 (right)" SEQ ID NO: 128). ITR-13 (left) and ITR-13 (right) are expected to form a structure with two arms, one of which (for example, arm C-C ') is truncated. Its unfolding Gibbs free energies are expected to be -82.9 kcal / mol.
[0054] [0054] Figure 23A shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm C-C' and B-B 'of an exemplified modified left ITR ("ITR-14 ( left) "SEQ ID NO: 129) and Figure 23B shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm B-B' and C-C 'of an exemplified modified right ITR ( "ITR-14 (right)" SEQ ID NO: 130). ITR-14 (left) and ITR-14 (right) are expected to form a structure with two arms, one of which (for example, arm C-C ') is truncated. Its unfolding Gibbs free energies are expected to be -80.5 kcal / mol.
[0055] [0055] Figure 24A shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm C-C' and arm B-C 'of an exemplified left modified ITR ("ITR-15 (left) "SEQ ID NO: 131) and Figure 24B shows the lowest expected energy structure of the RBE-containing portion of arm A-A 'and arm B-B' and C-C 'of a Example modified right ITR ("ITR-15 (right)" SEQ ID NO: 132). ITR-15 (left) and
[0056] [0056] Figure 25A shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm C-C' and arm B-C 'of an exemplified modified left ITR ("ITR-16 (left) SEQ ID NO: 133) and Figure 25B shows the expected lower energy structure of the RBE-containing portion of arm A-A 'and arm B-B' and C-C 'of an example of ITR modified right ("ITR-16 (right)" SEQ ID NO: 134). ITR-16 (left) and ITR-16 (right) are expected to form a structure with two arms, one of which ( for example, arm C-C ') is truncated and its unfolding Gibbs energies are expected to be -73.9 kcal / mol.
[0057] [0057] Figure 26A shows predicted structures of the portion containing RBE of the arm A-A 'and arm B-B' modified and / or arm C-C 'modified of exemplary modified ITRs listed in Table 10A. Figure 26B shows predicted structures of the RBE-containing portion of the A-A 'arm and modified C-C' arm and / or modified B-B 'arm of exemplary modified left ITRs listed in Table 10B. The structures shown are the smallest expected free energy structure. Color code: red => 99% probability; orange = 99% -95% probability; beige = 95-90% probability; dark green 90% -80%; bright green = 80% -70%; light blue = 70% -60%; dark blue 60% -50% and pink = <50%.
[0058] [0058] Figure 27 shows the luciferase activity of Sf9 GlycoBac insect cells transfected with mutant asymmetric ITR variants selected from Tables 10A and 10B. The ceDNA vector had a luciferase gene flanked by a WT ITR and a modified asymmetric ITR selected in Table 10A or 10B. "ITR-50 R without rep" is the recoverable mutant known without coinfection of Rep
[0059] [0059] Figure 28 shows a native agarose gel (1% agarose, 1x TAE buffer) of representative extracts of crude ceDNA from cultures of Sf9 insect cells transfected with ceDNA plasmids comprising a left wR ITR with another ITR selected from several mutant rights ITRs described in Table 10A. 2 ug of the total extract was loaded per strip. From left to right: Track 1) 1kb more ladder, Track 2) ITR-18 right, Track 3) ITR-49 Right track 4) ITR-19 right, Track 5) ITR-20 right, Track 6) ITR -21 right, Track 7) ITR-22 right, Track 8) ITR-23 right, Track 9) ITR-24 right, Track 10) ITR-25 right, Track 11) ITR-26 right, Track 12) ITR-27 right, Track 13) ITR-28 right, Track 14) ITR-50 right, track 15) 1kb more ladder.
[0060] [0060] Figure 29 shows a denaturing gel (0.8% alkaline agarose) of representative constructs from the ITR mutant library. The ceDNA vector is produced from constituted plasmids that comprise a left WT ITR with the other ITR selected from several right mutant ITRs revealed in Table 10A. From left to right, Track 1) 1kb Plus DNA Ladder, Track 2) ITR-18 blunt right, Track 3) ITR-18 Right restriction digest, Track 4) Blunt right ITR-19, Track 5) ITR- 19 Right restriction digest, Range 6) Uncut right ITR-21, Range 7) Right restriction digest, Range 8) Blunt right ITR-25, Range 9) ITR-25 Restriction digest right. The extracts were treated with EcoRI restriction endonuclease. Each mutant ceDNA is expected to have a unique EcoRI recognition site, producing two characteristic fragments, ~ 2,000 bp and ~ 3,000 bp, which will run at ~ 4,000 and ~ 6,000 bp, respectively, under denaturation conditions. Untreated ceDNA extracts are ~ 5,000 bp and it is expected that
[0061] [0061] Figure 30 shows the luciferase activity in vitro in HEK293 cells of the ITR-18 right, ITR-19 right, ITR-21 right and ITR-25 right and ITR-49 mutants, in which the left ITR in the ceDNA vector it is ITR WT. The "simulated" conditions are only reagents for transfection, with no donor DNA, and untreated is the negative control.
[0062] [0062] Unless otherwise defined in this document, the scientific and technical terms used in connection with this application will have the meanings that are commonly understood by those in the field to which this description belongs. It should be understood that this invention is not limited to the methodology, protocols and specific reagents, etc., described in this document and, as such, may vary. The terminology used in this document is intended to describe only particular modalities, and is not intended to limit the scope of the present invention, which is defined only by the claims. Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnoses and Therapy, 19th edition, published by Merck Sharp & Dohme Corp., 2011 (ISBN 978-0-911910-19-3); Robert S. Porter et al. (eds.), Fields Virology, 6th Edition, published by Lippincott Williams & Wilkins, Philadelphia, PA, USA (2013), Knipe, DM and Howley, PM (ed.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway´s Immunobi-
[0063] [0063] As used in this document, the terms "heterologous nucleotide sequence" and "transgene" are used interchangeably and refer to a nucleic acid of interest (other than a nucleic acid encoding a capsid polypeptide ) which is incorporated and can be delivered and expressed by a ceDNA vector as described here. Transgenes of interest include, without limitation, nucleic acids encoding polypeptides, preferably therapeutic (for example, for medical, diagnostic or veterinary use) or immunogenic polypeptides (for example, for vaccines). In some modalities, nucleic acids of interest include nucleic acids that are transcribed into therapeutic RNA. Transgenes included for use in the ceDNA vectors of the invention include, without limitation, those that express or encode one or more polypeptides, peptides, rhizomes, aptamers, peptide nucleic acids, siRNAs, RNAs, miRNAs, lncRNAs, oligo-antisense or polynucleotides, antibodies, antigen-binding fragments, or any combination thereof.
[0064] [0064] As used in this document, the terms "expression cassette" and "transcription cassette" are used interchangeably and refer to a linear stretch of nucleic acids that includes a transgene that is operationally linked to a or more promoters or other regulatory sequences sufficient to direct transcription of the transgene, but which does not comprise sequences encoding the capsid, other vector sequences or inverted terminal repeat regions. An expression cassette can additionally comprise one or more cis-acting sequences (for example, promoters, enhancers or repressors), one or more introns and one or more post-transcriptional regulatory elements.
[0065] [0065] As used herein, the term "terminal repetition" or "TR" includes any viral terminal repetition or synthetic sequence that comprises at least one minimum necessary origin of replication and a region comprising a hook structure. beautiful palindrome. A Rep binding sequence ("RBS") (also referred to as RBE (Rep binding element)) and a terminal resolution site ("TRS") together constitute a "minimum necessary source of replication" and, therefore, the TR comprises at least one RBS and at least one TRS. TRs that are the complement complement of each other within a given stretch of polynucleotide sequence are typically referred to as "inverted terminal repeat" or "ITR". In the context of a virus, ITRs mediate replication, virus packaging, provirus integration and rescue. As was unexpectedly found in the invention, TRs that are not complementary
[0066] [0066] As used in this document, the term "asymmetric ITRs" refers to a pair of ITRs within a single ceDNA genome or ceDNA vector that are not inverse complements over their entire length. The difference in sequence between the two ITRs may be due to the addition, deletion, truncation or point mutation of nucleotides. In one embodiment, one ITR in the pair may be a wild-type AAV sequence and the other a synthetic or non-wild-type sequence. In another modality, no ITR in the pair is a wild-type AAV sequence and the two ITRs differ in sequence.
[0067] [0067] As used in this document, the term "ceDNA genome" refers to an expression cassette that further incorporates at least one inverted terminal repeat region. A cDNA genome may further comprise one or more spacer regions. In some embodiments, the ceDNA genome is incorporated as an intermolecular duplex polynucleotide of DNA into a plasmid or viral genome.
[0068] [0068] As used in this document, the term "ceDNA spacer region" refers to an intermediate sequence that separates functional elements in the ceDNA vector or in the ceDNA genome. In some embodiments, the ceDNA spacer regions maintain two functional elements at a desired distance for optimal functionality. In some embodiments, the ceDNA spacer regions provide or enhance the genetic stability of the ceDNA genome within, for example, a plasmid or baculovirus. In some embodiments, the ceDNA spacer regions facilitate ready genetic manipulation of the ceDNA genome, providing a convenient location for cloning sites and the like. For example, in certain respects, a "polylinker" oligonucleotide containing several restriction endonuclease sites or an unopened reading frame sequence designed to have no known binding site for the protein (eg, factor transcription) can be positioned in the ceDNA genome to separate cis-action factors, for example, insertion of 6mer, 12mer, 18mer, 24mer, 48mer, 86mer, 176mer, etc. between the terminal resolution site and the regulatory element
[0069] [0069] As used in this document, the terms "Rep binding site", Rep binding element, "RBE" and "RBS" are used interchangeably and refer to a binding site for the Rep protein (for example, AAV Rep 78 or AAV Rep 68) that by binding a Rep protein allows the Rep protein to perform its site-specific endonuclease activity in the sequence that incorporates RBS. A RBS sequence and its inverse complement together form a single RBS. RBS sequences are known in the art and include, for example, 5'-GCGCGCTCGCTCGCTC-3 '(SEQ ID NO: 531), an RBS sequence identified in AAV2. Any known RBS sequence can be used in the embodiments of the invention, including other known AAV RBS sequences and other naturally known or synthetic RBS sequences. Without being limited by theory, it is thought that the nuclease domain of a Rep protein binds to the duplex nucleotide sequence GCTC and, therefore, the two known Rep AAV proteins bind directly and mount stably on the duplex oligonucleotide, 5 '- (GCGC) (GCTC) (GCTC) (GCTC) -3' (SEQ ID NO: 531). In addition, the soluble conformable aggregates (ie, indefinite number of interassociated Rep proteins) dissociate and bind to oligonucleotides that contain Rep binding sites. Each Rep protein interacts with the nitrogenous bases and the main structure of the phosphodiester in each tape. Interactions with nitrogenous bases provide sequence specificity, whereas interactions with the phosphodiester backbone are no or less sequence specific and stabilize the protein-DNA complex.
[0070] [0070] As used in this document, the terms "terminal resolution site" and "TRS" are used interchangeably in this document and refer to a region in which Rep forms a tyrosine-phosphodiester bond with the 5 'thymidine generating a 3 'OH that serves as a substrate for DNA extension through a cellular DNA polymerase, for example, DNA pol delta or DNA pol epsilon. Alternatively, the Rep-thymidine complex can participate in a coordinated bonding reaction. In some embodiments, a TRS minimally covers an unpaired thymidine based. In some embodiments, the cutting efficiency of the TRS can be controlled at least in part by its distance within the same molecule as the RBS. When the accepting substrate is the complementary ITR, the resulting product is an intramolecular duplex. TRS sequences are known in the art and include, for example, 5'-GGTTGA-3 '(SEQ ID NO: 45), the hexanucleotide sequence identified in AAV2. Any known TRS sequence can be used in the embodiments of the invention, including other known AAV TRS sequences and other naturally known or synthetic TRS sequences, such as AGTT (SEQ ID NO: 46), GGTTGG (SEQ ID NO: 47), AGTTGG (SEQ ID NO: 48), AGTTGA (SEQ ID NO: 49) and other reasons like RRTTRR (SEQ ID NO: 50).
[0071] [0071] As used in this document, the term "ceDNA plasmid" refers to a plasmid that comprises a ceDNA genome as an intermolecular duplex.
[0072] [0072] As used in this document, the term "ceDNA-bacmid" refers to an infectious baculovirus genome that comprises a ceDNA genome as an intermolecular duplex that has the ability to propagate in E. coli as a plasmid and therefore can operate as a shuttle vector for baculovirus.
[0073] [0073] As used in this document, the term "ceDNA-baculovirus" refers to a baculovirus that comprises a ceDNA genome as an intermolecular duplex within the baculovirus genome.
[0074] [0074] As used in this document, the terms "ceDNA-baculovirus-infected insect cell" and "ceDNA-BIIC" are used interchangeably and refer to an inverted host cell (including, without limitation an insect cell (for example, an Sf9 cell)) infected with a ceDNA-baculovirus.
[0075] [0075] As used in this document, the terms "closed DNA vector", "ceDNA vector" and "ceDNA" are used interchangeably and refer to a DNA vector without capsids without viruses with at least a covalently closed end (i.e., an intramolecular duplex). In some embodiments, the ceDNA comprises two covalently closed ends.
[0076] [0076] As defined in this document, "reporters" refer to proteins that can be used to provide detectable readings. Reporters often produce a measurable signal, such as fluorescence, color or luminescence. The coding sequences for reporter proteins encode proteins whose presence in the cell or organism is easily observed. For example, fluorescent proteins cause a fluorescent cell when excited with light of a specific wavelength, luciferases cause a cell to catalyze a reaction that produces light, and enzymes such as β-galactosidase convert a substrate into a colored product . Exemplary reporter polypeptides useful for experimental or diagnostic purposes include, without limitation β-lactamase, β-galactosidase (LacZ), alkaline phosphatase (AP), thymidine kinase (TK), fluorescent green protein (GFP) and other fluorescent proteins, chloramphenicol acetyltransferase (CAT), luciferase and others well known in the art.
[0077] [0077] As used herein, the term "effector protein" refers to a polypeptide that provides a detectable reading, such as, for example, a reporter polypeptide, or more appropriately, such as a polypeptide that kills a cell, for example example, a toxin or an agent that makes a cell susceptible to killing with a chosen agent or lack thereof. Effector proteins include any protein or peptide that directly targets or damages the host cell's DNA and / or RNA. For example, effector proteins may include, without limitation, a restriction endonuclease that targets a host cell DNA sequence (either genomic or an extrachromosomal element), a protease that degrades a necessary polypeptide target for cell survival, a DNA gyrase inhibitor and a ribonuclease-type toxin. In some embodiments, the expression of an effector protein controlled by a synthetic biological circuit, as described in this document, can participate as a factor in the other synthetic biological circuit to expand the range and thus the complexity of a responsiveness of the biological circuit system .
[0078] [0078] Transcription regulators refer to activators and transcription repressors that activate or repress the transcription of a gene of interest. Promoters are regions of nucleic acid that initiate transcription of a specific gene. Transcription activators typically bind close to transcription promoters and recruit RNA polymerase to initiate transcription directly. The reporters bind to the transcription promoters and make stereotypically difficult to initiate transcription by RNA polymerase. Other transcription regulators can serve as activators or repressors, depending on where they bind and on cellular and environmental conditions. Non-limiting examples of transcriptional regulatory classes include, without limitation, domestic domain proteins, zinc finger proteins, winged helix proteins (fork heads) and leucine zipper proteins.
[0079] [0079] As used in this document, a "repressor protein" or "inducer protein" is a protein that binds to a regulatory sequence element and represses or activates, respectively, the transcription of sequences operably linked to the sequence element. regulatory authority. Preferred repressor and inducer proteins, as described herein, are sensitive to the presence or absence of at least one environmental entry or entry agent. Preferred proteins as described herein are modular in form, comprising, for example, separable binding elements or domains for binding to DNA and binding to the input or responsive agent.
[0080] [0080] As used in this document, "vehicle" includes any and all solvents, dispersion medium, carriers, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption retarding agents, buffers, support solutions, suspensions, colloids and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. The term "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an undesirable toxic, allergic or similar reaction when administered to a host.
[0081] [0081] As used in this document, an "agent-responsive domain" is a transcription factor domain that binds to or responds to a condition or input agent in a way that makes it a link fusion domain bound DNA responsive to the presence of that condition or entry. In one embodiment, the presence of the condition or entry results in a conformational change in the responsive domain of the entry agent or in a protein to which it is fused, which modifies the transcription modulation activity of the transcription factor .
[0082] [0082] The term "in vivo" refers to tests or processes that occur in or within an organism, such as a multicellular animal.
[0083] [0083] The term "promoter" as used herein, refers to any nucleic acid sequence that regulates the expression of another nucleic acid sequence by directing the transcription of the nucleic acid sequence, which may be a heterologous target gene that encodes a protein or an RNA. Promoters can be constitutive, inducible, repressible, tissue-specific or any combination thereof. A promoter is a control region for a nucleic acid sequence in which the initiation and transcription rate of the rest of a nucleic acid sequence are controlled. A promoter can also contain genetic elements to which proteins and regulatory molecules can bind, such as RNA polymerase and other transcription factors. In some modalities of the aspects described here, a promoter can direct the expression of a transcription factor that regulates the expression of the promoter itself or of another promoter used in another modular component of the synthetic biological circuits described here. Within the promoter sequence, a transcription initiation site will be found, as well as the
[0084] [0084] The term "intensifier", as used in this document, refers to a regulatory sequence of cis action (for example, 50-
[0085] [0085] It can be said that a promoter directs expression or directs transcription of the nucleic acid sequence that it regulates. The expressions "operatively linked", "operatively positioned", "operatively linked", "under control" and "under transcriptional control" indicate that a promoter is in the correct functional and / or orientation zone in relation to a nucleic acid sequence that regulates to control initiation of transcription and / or expression of that sequence. An "inverted promoter", as used herein, refers to a promoter, in which the nucleic acid sequence is in reverse orientation, so that what was the coding strand is now the non-coding strand, and vice versa . Inverted promoter sequences can be used in several ways to regulate the status of a switch. In addition, in several modalities, a promoter can be used in conjunction with an intensifier.
[0086] A promoter can be one naturally associated with a gene or sequence, as can be obtained by isolating the 5 'non-coding sequences located upstream of the coding segment and / or exon of a given gene or sequence. This promoter can be referred to as "endogenous". Likewise, in some modalities, an intensifier can be one naturally associated with a nucleic acid sequence, located downstream or upstream of said sequence.
[0087] [0087] In some embodiments, a segment of encoding nucleic acid is positioned under the control of a "recombinant promoter" or "heterologous promoter", both of which refer to a promoter that is not normally associated with the sequence encoded nucleic acid, is operationally linked to its natural environment. A recombinant or heterologous enhancer refers to an enhancer that is not normally associated with a given nucleic acid sequence in its natural environment. Such promoters or enhancers can include promoters or enhancers for other genes; promoters or enhancers isolated from any other prokaryotic, viral or eukaryotic cell; and synthetic promoters or enhancers that are not "naturally occurring", that is, understanding different elements from different regulatory regions of transcription and / or mutations that alter expression through methods of genetic manipulation that are known in the art . In addition to synthetically producing promoter and enhancer nucleic acid sequences, promoter sequences can be produced using recombinant cloning and / or nucleic acid amplification technology, including PCR, in connection with synthetic biological circuits and modules. described in this document (see, for example, US 4,683,202, US
[0088] [0088] As described in this document, an "inducible promoter" is one that is characterized by initiating or enhancing transcriptional activity when in the presence of, influenced by or contacted by an inducer or inducing agent. An "inducer" or "inducing agent" as defined herein, can be endogenous, or a normally exogenous compound or protein that is administered in a manner as to be active in inducing transcriptional activity from the inducible promoter. In some embodiments, the inducer or inducing agent, that is, a chemical, compound or protein, may be the result of the transcription or expression of a nucleic acid sequence (that is, an inducer may be an inducing protein expressed by other component or module), which in itself may be under control or an inducible promoter. In some embodiments, an inducible promoter is induced in the absence of certain agents, such as a repressor. Examples of inducible promoters include, but are not limited to, tetracycline, metallothionine, ecdysone, mammalian virus (for example, adenovirus late promoter; and long term mouse mammary tumor virus repeat (MMTV-LTR)) and other promoters responsive to steroids, rapamycin responsive promoters and the like.
[0089] [0089] The term "individual", as used in this document, refers to a human or animal being treated, including prophylactic treatment, with the ceDNA vector according to the present invention. Usually, the animal is a vertebrate such as, without limitation, primate, rodent, domestic animal or game animal. Primates include, without limitation, chimpanzees, cynomological monkeys, spider monkeys and monkeys, for example, Rhesus. Rodents include rats, mice, marmots, ferrets, rabbits and hamsters. Domestic and game animals include, but are not limited to, cows, horses, pigs, deer, bison, buffalo, feline species, for example, domestic cat, canine species, for example, dog, fox, wolf, avian species, for example, chicken, emu, ostrich and fish, for example, trout, catfish and salmon. In certain aspects of the aspects described here, the individual is a mammal, for example, a primate or a human. A subject can be male or female. In addition, an individual can be a baby or a child. In some modalities, the individual may be a newborn or unborn, for example, the individual is in the womb. Preferably, the individual is a mammal. The mammal may be a human, non-human primate, mouse, rat, dog, cat, horse or cow, but it is not limited to these examples. Mammals other than humans can be used to advantage as individuals representing animal models of diseases and disorders. In addition, the methods and compositions described here can be used for domesticated animals and / or pets. A human individual can be of any age, sex, race or ethnic group, for example, Caucasian (white), Asian, African, black, African American, African European, Hispanic, Middle Eastern, etc. In some embodiments, the individual may be a patient or another individual in a clinical setting. In some modalities, the individual is already under treatment.
[0090] [0090] As used in this document, the term "antibody" is used in the broadest sense and encompasses various antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (eg, bispecific antibodies) and fragments antibodies, as long as they exhibit the desired antigen-binding activity. An "antibody fragment" refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the same antigen to which the intact antibody binds. In one embodiment, the antibody or antibody fragment comprises an immunoglobulin chain or a
[0091] [0091] As used in this document, the term "antigen-binding domain" of an antibody molecule refers to that part of an antibody molecule, for example, an immunoglobulin (Ig) molecule, which participates in antigen binding . In modalities, the antigen-binding site is formed by amino acid residues from the variable (V) regions of the heavy (H) and light (L) chains. Three highly divergent stretches in the variable regions of the heavy and light chains, called hypervariable regions, are arranged between more conserved flanking stretches, called "framework regions" (FRs). FRs are sequences of amino acids that are naturally found between and adjacent to hypervariable regions in immunoglobulins. In the modalities, in an antibody molecule, the three hypervariable regions of a light chain and the three hypervariable regions of a heavy chain are arranged in relation to each other in three-dimensional space to form a binding surface to the antigen, which it is complementary to the tri-dimensional surface of a bound antigen. The three hypervariable regions of each of the heavy and light chains are called "complementarity determining regions" or "CDRs". The framework region and CDRs have been defined and described, for example, in Kabat, EA, et al. (1991) Sequences of Processes of Immunological Interest, Fifth Edition, US Department of Health and Human Services, NIH Publication No. 91-3242, and Chothia, C. et al. (1987) J. Mol. Biol. 196: 901-917. Each variable chain (for example, variable heavy chain and variable light chain) is typically composed of three CDRs and four FRs, arranged from the amino terminal to the carboxy terminal in the order of amino acids: FR1, CDR1, FR2, CDR2, FR3 , CDR3 and FR4.
[0092] [0092] As used in this document, the term "full length antibody" refers to an immunoglobulin (Ig) molecule (for example, an IgG antibody), for example, which occurs naturally and is formed by normal recombinatory processes of fragments of immunoglobulin genes.
[0093] [0093] As used in this document, the term "functional antibody fragment" refers to a fragment that binds to the same antigen.
[0094] [0094] As used herein, an "immunoglobulin variable domain sequence" refers to an amino acid sequence that can form the structure of an immunoglobulin variable domain. For example, the sequence may include all or part of the amino acid sequence of a naturally occurring variable domain. For example, the sequence may or may not include one, two or more N or C-terminal amino acids or it may include other changes compatible with the formation of the protein structure
[0095] [0095] As used in this document, the term "comprising" or "comprises" is used in reference to compositions, methods and their components, which are essential for the method or composition, but open to the inclusion of unspecified elements, es - essential or not.
[0096] [0096] As used in this document, the term "consisting essentially of" refers to the elements necessary for a particular modality. The term allows the presence of elements that do not materially affect the basic and innovative characteristic (or characteristics) of that modality.
[0097] [0097] The term "consisting of" refers to compositions, methods and their components, as described in this document.
[0098] [0098] As used in this specification and in the appended claims, the singular forms "one", "one" and "o / a" include plural references, unless the context clearly indicates otherwise. Thus, for example, references to the "method" include one or more methods and / or steps of the type described here and / or which will become apparent to persons skilled in the art when reading this description and so on. Likewise, the word "or" intends to include "and", unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in practice or in testing this description, suitable methods and materials are described below. The abbreviation, "e.g." is derived from the Latin gratia example and is used here to indicate a non-limiting example. Thus, the abbreviation "e.g." is synonymous with the term "for example".
[0099] [0099] In addition to the operational examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used in these documents must be understood as modified in all instances by the term "about ". The term "about" when used in connection with percentages can mean ± 1%. The present invention is further explained in detail by the following examples, but the scope of the invention should not be limited to that.
[00100] [00100] It should be understood that this invention is not limited to the methodology, protocols and specific reagents, etc., described herein and, as such, may vary. The terminology used in this document is intended to describe only particular modalities, and is not intended to limit the scope of the present invention, which is defined only by the claims.
[00101] [00101] New ceDNA molecules, non-viral and capsid-free, with covalently closed ends (ceDNA) are provided in this document. These non-viral ceDNA molecules without capsid can be produced in permissive host cells from an expression construct (for example, a ceDNA plasmid, a ceDNA-bacmid, a ceDNA-baculovirus or an integrated cell line) containing a heterologous gene (transgene) positioned between two different sequences of inverted terminal repetition (ITR), in which the ITRs are different from each other. In some modalities, one of the ITRs is modified by deletion, insertion and / or substitution compared to a wild type ITR sequence (for example, AAV ITR); and at least one of the ITRs comprises a functional terminal resolution site (trs) and a Rep binding site. The ceDNA vector is preferably duplex, for example, self-complementing, over at least a portion of the molecule , like the expression cassette (for example, ceDNA is not a double-stranded circular molecule). The ceDNA vector has covertly closed ends and is therefore resistant to digestion with exonucleases (eg, exonuclease I or exonuclease III), for example, for more than an hour at 37 ° C.
[00102] [00102] The ceDNA vectors described in this document have no packaging restrictions imposed by the limited space within the viral capsid. CeDNA vectors represent a viable alternative produced by eukaryotes to plasmid DNA vectors produced in prokaryotes, as opposed to encapsulated AAV genomes. This allows the insertion of control elements, for example, regulatory switches, as described in this document, large transgenes, multiple transgenes, etc.
[00103] [00103] In one aspect, a ceDNA vector comprises, in the
[00104] [00104] The wild-type or mutated or otherwise modified ITR sequences provided herein represent DNA sequences included in the expression construct (for example, ceDNA-plasmid, ceDNA-bacmid, ceDNA-baculovirus) for the production of the ceDNA vector. Thus, the ITR sequences effectively contained in the ceDNA vector produced from the ceDNA-plasmid or other expression construct may or may not be identical to the ITR sequences provided in this document as a result of the naturally occurring changes that occur during the production process (for example, replication error)
[00105] [00105] In some embodiments, a ceDNA vector described in this document, which comprises the expression of cassettes with a transgene, which can be, for example, a regulatory sequence,
[00106] [00106] In an embodiment in each of these aspects, an expression cassette is located between two ITRs comprised in the following order with one or more of: a promoter operatively linked to a transgene, a post-transcriptional regulatory element, and a polyadenylation and termination signal. In one embodiment, the promoter is adjustable - inducible or repressible. The promoter can be any sequence that facilitates transcription of the transgene. In one embodiment, the promoter is a CAG promoter (for example, SEQ ID NO: 03), or variations thereof. The post-transcriptional regulatory element is a sequence that modulates the expression of the transgene, as a non-limiting example, any sequence that creates a tertiary structure that improves the expression of the transgene.
[00107] [00107] In one embodiment, the post-transcriptional regulatory element comprises WPRE (for example, SEQ ID NO: 08). In one embodiment, the polyadenylation and termination signal comprises BGHpolyA (for example, SEQ ID NO: 09). Any cis regulating element known in the art, or a combination thereof, may additionally be used, for example, SV40 delayed polyA upstream sequence (USE), or other post-transcriptional processing elements, including, without limitation, the thymidine kinase of the herpes simplex virus gene, or hepatitis B virus (HBV). In one embodiment, the length of the expression cassette in the 5 'to 3' direction is greater than the maximum known length to be encapsulated in an AAV virion. In one mode, the length is greater than 4.6kb, or greater than 5kb, or greater than 6kb, or greater than 7kb. Several expression cassettes are exemplified in this document.
[00108] [00108] The expression cassette can comprise more than
[00109] The expression cassette may also include an internal ribosome entry site (IRES) and / or an element 2a. The elements
[00110] [00110] Figures 1A-1C show non-limiting exemplary ceD-NA vector schemes or the corresponding plasmid sequence of ceDNA. The ceDNA vectors are capsid free and can be obtained from a plasmid that encodes in that order: a first ITR, an expressible transgene cassette and a second ITR, in which at least one of the first and / or the second ITR sequence is mutated in relation to the corresponding wild-type AAV2 ITR sequence. The expressible transgene cassette preferably includes, in the present application, one or more of: an enhancer / promoter, an ORF reporter (transgene), a post-transcriptional regulatory element (eg, WPRE), and a polyadenylation signal and termination (for example, BGH polyA)
[00111] [00111] The expression cassette can comprise any transgenic of interest. Transgenes of interest include, without limitation, nucleic acids encoding polypeptides, or noncoding nucleic acids (eg, RNAi, MIRs, etc.) preferably therapeutic polypeptides (eg, for medical, diagnostic or veterinary uses) or immunogenic (for example, for vaccines). In certain embodiments, the transgenes in the expression cassette encode one or more polypeptides, peptides, ribozymes, peptide nucleic acids, siRNAs, RNAs, antisense oligonucleotides, antisense polynucleotides, antibodies, antigen-binding fragments, or any combination thereof. In some embodiments, the transgene is a therapeutic gene or a marker protein. In some ways, the transgene is an agonist or antagonist. In some modalities, the antagonist is a mimetic or antibody, or antibody fragment, or antigen-binding fragments thereof, for example, a neutralizing antibody or antibody fragment and the like. In some embodiments, the transgene encodes an antibody, including a complete antibody or antibody fragment, as defined herein. In some embodiments, the antibody is an antigen binding domain or an immunoglobulin variable domain sequence, as defined herein.
[00112] [00112] In particular, the transgene can encode one or more therapeutic agents, including, without limitation, for example, protein (or proteins), polypeptide (or polypeptides), peptide (peptides), enzyme (enzymes), antibodies, antigen-binding fragments, as well as variants, and / or active fragments thereof, for use in the treatment, prophylaxis, and / or amelioration of one or more symptoms of a disease, dysfunction, injury, and / or disorder . Examples of transgenes are described in this document in the section entitled "Treatment Method".
[00113] [00113] There are many structural features of ceDNA vectors that differ from plasmid-based expression vectors. The ceDNA vectors can have one or more of the following characteristics: the lack of original bacterial DNA (that is, not inserted), the lack of a prokaryotic origin of replication, being self-containing, that is, they do not require any sequences in addition to the two ITRs,
[00114] [00114] The ceDNA vectors produced by the methods provided in this document preferably have a linear and continuous structure, rather than a non-continuous structure, as determined by restriction enzyme digestion assay (Figure 4D). It is believed that the linear and continuous structure is more stable against attack by cellular endonucleases, as well as less likely to be recombined and cause mutagenesis. Thus, a ceDNA vector in the linear and continuous structure is a preferred modality. The single-stranded, linear, continuous intramolecular duplex ceDNA vector may have terminal ends covalently linked, without sequences encoding AAV capsid proteins. These cDNA vectors are structurally distinct from plasmids (including plasmid cDNAs described herein), which are circular duplex nucleic acid molecules of bacterial origin. Complementary strands of plasmids can be separated after denaturation to produce two nucleic acid molecules, while, on the other hand, ceDNA vectors, while having complementary strands, are a single DNA molecule and therefore even if denatured, they remain a single molecule. In some embodiments, the ceDNA vectors as described here can be produced without methylation of the prokaryotic DNA base, unlike plasmids. Therefore, the plasmid ceDNA and ceDNA vectors are different both in terms of structure (in particular, linear versus circular) and also in view of the methods used to produce and purify these different objects (see below), and also in view of the its DNA methylation, which is of the prokaryotic type for ceDNA-plasmids and of the eukaryotic type for the ceDNA vector.
[00115] [00115] Several advantages of a ceDNA vector described in this document over plasmid-based expression vectors include, without limitation: 1) plasmids contain bacterial DNA sequences and are subjected to prokaryotic specific methylation, for example example, methylation of 6-methyl adenosine and 5-methyl cytosine, whereas AAV vector sequences without capsid are of eukaryotic origin and are not subjected to specific prokaryotic methylation; as a result, AAV vectors without capsid are less likely to induce inflammatory and immune responses compared to plasmids; 2) while plasmids require the presence of a resistance gene during the production process, ceDNA vectors do not; 3) while a circular plasmid is not delivered to the nucleus upon introduction into a cell and requires overload for deviation from degradation by cellular nucleases, ceDNA vectors contain cis-viral elements, that is, ITRs, which confer resistance the nucleases in can be designed to be targeted and delivered to the nucleus. It is hypothesized that the elements of minimum definition indispensable for ITR function are a Rep binding site (RBS; 5'-GCGCGCTCGCTCGCTC-3 '(SEQ ID NO: 531)
[00116] [00116] As described in this document, ceDNA vectors contain a heterologous gene positioned between two inverted terminal repeat (ITR) sequences, which differ (that is, they are asymmetric ITRs). In some modalities, at least one of the ITRs is modified by deletion, insertion, and / or substitution, as compared to a wild type ITR sequence (for example, the AAV ITR); and at least one of the ITRs comprises a functional Rep binding site (RBS; for example, 5'-GCGCGCTCGCTCGCTC-3 'for AAV2, SEQ ID NO: 531) and a functional terminal resolution site (TRS; for example, 5'-AGTT-3 ', SEQ ID NO: 46). In one modality, at least one of the ITRs is a non-functional ITR. In one embodiment, the different ITRs are not, each one, wild type ITR of different serotypes.
[00117] [00117] Although the ITRs exemplified in the specification and examples here are AAV2 ITRs, one of those skilled in the art is aware that he can, as indicated above, use ITRs of any known parvovirus, for example a dependovirus such as AAV (eg noma AAV1, AAV2, AAV3, AAV4, AAV5, AAV 5, AAV7, AAV8, AAV9,
[00118] [00118] In some modalities, the ITR sequence may be from viruses of the family Parvoviridae, which includes two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect insects. The subfamily Parvovirinae (referred to as parvoviruses) includes the genus Dependovirus, the members that, under most conditions, require co-infection with a helper virus, such as adenovirus or herpes virus for productive infection. The Dependovirus genus includes adenoassociated viruses (AAV), which normally infects humans (for example, serotypes 2, 3A, 3B, 5, and 6) or primates (for example, serotypes 1 and 4), and related viruses that infect other warm-blooded animals (eg, bovine, canine, equine and sheep adenoassociated viruses). Parvoviruses and other members of the Parvoviridae family are generally described in Kenneth I. Berns, "Parviviridae: The Viruses and Their Replication," Chapter 69 in VIRO-LOGY FIELD (3rd Ed. 1996).
[00119] [00119] One skilled in the art is aware that ITR strings have a common structure of a double-strand Holliday junction, which typically has a T-shaped or Y-shaped hairpin structure (see, for example, Figures 2A and 3A), where each
[00120] [00120] Specific changes and mutations in ITRs are described in detail here, but in the context of ITRs, "altered" or "mutants" indicates that nucleotides have been inserted, deleted and / or replaced in relation to the type of ITR sequence wild, reference or original, and can be altered in relation to each other by flanking ITR in a ceDNA vector that has two flanking ITRs. The altered or mutated ITR can be a manipulated ITR. As used in this document, "manipulated" refers to the aspect of having been manipulated by the hand of man. For example, a polypeptide is considered "manipulated", when in at least one aspect of the polypeptide, for example, its sequence, was manipulated by the hand of man to differ from the aspect as it exists in nature.
[00121] [00121] In some modalities, an ITR can be synthetic. In one embodiment, a synthetic ITR is based on the ITR sequences of more than one AAV serotype. In another embodiment, a synthetic ITR does not include AAV-based sequences. In yet another fashion, a synthetic ITR preserves the structure of the ITR described above, although it has only some or no sequence originated by
[00122] [00122] ITR strings have a common structure of a double-strand Holliday junction, which is usually a T or Y-shaped hairpin structure (see, for example, Figures 2A and 3A), in which each ITR is formed by two palindromic arms or loops (B-B 'and C-C') incorporated in a larger palindromic arm (A-A '), and a single ribbon D sequence (where the order of these palindromic sequences define the ITR 'flip' or 'flop' orientation. One skilled in the art can readily determine ITR sequences or modified ITR sequences from any AAV serotype for use in a ceDNA or ceDNA plasmid vector based on the exemplary AAV2 ITR sequences provided herein. See, for example, the comparison of ITR sequences for different AAV serotypes (AAV1-AAV6 and avian AAV (AAAV) and bovine AAV (BAAV)) described in Grimm et al., J. Virology, 2006; 80 (1); 426-439; showing the percentage of identity of the left ITR of AAV2 with the left ITR of other serotypes: AAV-1 (84%), AAV-3 (86%), AAV-4 (79%), AAV-5 (58%), AAV-6 (left ITR) (100%) and AAV-6 (right ITR) (82%).
[00123] Therefore, while the AAV2 ITRs are used as examples of ITRs in the ceDNA vectors described herein, a ceDNA vector described in this document can be prepared with or based on ITRs from any known AAV serotype, including , for example, AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AVV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), AAV 10 serotype
[00124] [00124] Any parvovirus ITR can be used as an ITR or as a basic ITR for modification. Preferably, the parvovirus is a dependent virus. Most preferably, AAV. The chosen serotype can be based on the tropism of serotype tissue. AAV2 has a wide tissue tropism, AAV1 preferentially targets neuronal and skeletal muscle, and AAV5 preferentially targets neuronal retinal pigmented epithelium, and photoreceptors. AAV6 targets mainly skeletal muscle and lung. AAV8 preferentially targets liver, skeletal, cardiac and pancreatic tissues. AAV9 preferentially targets liver, skeletal and pulmonary tissue. In one embodiment, the modified ITR is based on an AAV2 ITR. For example, it is selected from the group consisting of: SEQ ID NO: 2 and SEQ ID NO: 52. In a modality of each of these aspects, the polynucleotide vector comprises a pair of ITRs, selected from the group consisting of : SEQ ID NO: 1 and SEQ ID NO: 52; and SEQ ID NO: 2 and SEQ ID NO: 51. In an embodiment of each of these aspects, the polynucleotide vector or non-viral DNA vectors without capsid with covalently closed ends comprise a pair of different ITRs. selected from the group consisting of: SEQ ID NO: 101 and SEQ ID NO: 102; SEQ ID NO: 103 and SEQ ID NO: 104, SEQ ID NO: 105 and SEQ ID NO: 106; SEQ ID NO: 107 and SEQ ID NO: 108; SEQ ID NO: 109 and SEQ ID NO: 110; SEQ ID NO: 111 and SEQ ID NO: 112; SEQ ID NO: 113 and SEQ ID NO: 114; and SEQ ID NO: 115 and SEQ ID NO: 116. In some embodiments, a modified ITR is selected from any of the ITRs, or partial ITR sequences of SEQ ID NO: 2, 52, 63, 64, 101-499 or 545-547.
[00125] [00125] In some embodiments, a ceDNA vector can comprise an ITR with a modification in the ITR corresponding to any of the modifications in the ITR sequences or partial ITR sequences shown in any one or more of Tables 2, 3, 4 , 5, 6, 7, 8, 9, 10A and 10B herein, or the sequences shown in Figure 26A or 26B.
[00126] [00126] In some modalities, the ceDNA can form a secondary intramolecular duplex structure. The secondary structure of the first ITR and the second asymmetric ITR is exemplified in the context of wild-type ITRs (see, for example, Figures 2A, 3A, 3C) and modified ITR structures (see, for example, Fi- figures 2B and 3B, 3D). Secondary structures are inferred or predicted based on the ITR sequences of the plasmid used to produce the ceDNA vector. The secondary exemplifying structures of
[00127] [00127] In one embodiment, the left ITR of the ceDNA vector is modified or mutated in relation to a wild-type AAV (wt) ITR structure and the right ITR is a wild-type AAV ITR. In one embodiment, the right ITR of the ceDNA vector is modified in relation to a wild-type AAV ITR structure, and the left ITR is a wild-type AAV ITR. In such modality, a modification of the ITR (for example, the left or right ITR) can be generated by a deletion, insertion or substitution of one or more nuclei of the wild-type ITR derived from the AAV genome.
[00128] [00128] The ITRs used here can be resolvable and not resolvable, and selected for use in the ceDNA vectors are preferably AAV sequences, with serotypes 1, 2, 3, 4, 5, 6, 7 being preferred, 8 and 9. Resolvable AAV ITRs do not require a wild-type ITR sequence (for example, the endogenous or wild-type AAV ITR sequence can be altered by insertion, deletion, truncation and / or antisense mutations) , as long as the repetition of the terminal measures the desired functions, for example,
[00129] [00129] In one embodiment, the ceDNA may include an ITR structure that is mutated relative to one of the wild type ITRs disclosed here, but in which the mutant or modified ITR still retains an operable Rep-binding site (RBE or RBE ') and a terminal resolution site (three). In one embodiment, the mutant ceDNA ITR includes a functional replication protein site (RPS-1) and a competent replication protein that binds to the RPS-1 site is used in production.
[00130] [00130] In one modality, at least one of the ITRs is a defective ITR with respect to the connection to Rep and / or Rep nicking. In one modality, the defect is at least 30% in relation to a reduction type ITR wild; in other modalities, it is at least 35% ..., 50% ..., 65% ..., 75% ..., 75% ..., 85% ..., 90% ..., 95% ..., 98% ..., or completely lacking in function or any point in between. Host cells do not express viral capsid proteins and the polynucleotide vector model is devoid of any viral capsid coding sequence. In one embodiment, the models of polynucleotide vectors and host cells that are devoid of AAV capsid genes and the resulting protein also do not encode or express capsid genes from other viruses. In addition, in a specific embodiment, the nucleic acid molecule is also devoid of coding sequences for the AAV Rep protein.
[00131] [00131] In some modalities, the structural element of the ITR may be any structural element that is involved in the functional interaction of the ITR with a large Rep protein (for example, Rep 78 or Rep 68). In certain embodiments, the structural element provides selectivity for the interaction of an ITR with a large Rep protein, that is, it determines at least in part which Rep protein functionally interacts with the ITR. In other embodiments, the structural element physically interacts with a large Rep protein when the Rep protein is linked to ITR. Each structural element can be, for example, a secondary structure of the ITR, a nucleotide sequence of the ITR, a spacing between two or more elements, or a combination of any of the above. In one embodiment, the structural elements are selected from the group consisting of an arm A and A ', an arm B and a B', an arm C and C ', an arm D, a site of connection to Rep (RBE ) and an RBE '(i.e., complementary RBE sequence) and a terminal resolution breeder (three).
[00132] [00132] More specifically, the ability of a structural element to functionally interact with a given large Rep protein can be altered by modifying the structural element. For example, the nucleotide sequence of the structural element can be modified compared to the wild-type sequence of the ITR. In one embodiment, the structural element (for example, arm A, arm A ', arm B, arm B', arm C, arm C ', arm D, RBE, RBE' and three) of an ITR can be removed and replaced by a wild-type structural element of a different parvovirus. For example, the replacement structure can be AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, snake parvovirus (e.g., real python parvovirus), parvovirus bovine, goat parvovirus, avian parvovirus, canine parvovirus,
[00133] [00133] For example only, Table 1 indicates exemplary modifications of at least one nucleotide (for example, an exclusion, insertion and / or substitution) in regions of modified ITRs, where X is indicative of a modification of at least one nucleic acid (for example, an exclusion, insertion and / or substitution) in that section in relation to the corresponding wild-type ITR. In some embodiments, any modification of at least one nucleotide (for example, a deletion, insertion and / or substitution) in any of the regions of C and / or C 'and / or B and / or B 'retains three sequential T nucleotides (ie TTT) in at least one terminal loop. For example, if the modification results in: a single arm ITR (for example, a single CC 'arm or a single B-B' arm) or a modified CB 'arm or a C'-B arm, or a two arms with at least one truncated arm (for example, a truncated CC 'arm and / or truncated B-B' arm), at least the single arm or at least one arm of a two-arm ITR (where one arm can be truncated) retains three sequential T nucleotides (ie TTT) in at least one terminal loop. In some embodiments, a truncated C-C 'arm and / or a truncated B-B' arm has three sequential T nucleotides (i.e., TTT) in the terminal loop.
[00134] [00134] Table 1: Exemplary combinations of modifications of at least one nucleotide (for example, a deletion, insertion and / or substitution) in different B-B 'and C-C' regions or arms of ITRs (X indicates a modification of nucleotide, for example, addition, deletion or replacement of at least one nucleotide in the region). Region B Region B ’Region C Region C’ X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X
[00135] [00135] In some embodiments, an ITR modified for use in this document may include any of the combinations of modifications shown in Table 1, and also a modification of at least one nucleotide in any one or more of the regions selected from : between A 'and C, between C and C', between C 'and B, between B and B' and between B 'and A. In some embodiments, any modification of at least one nucleotide (for example, a deletion, insertion and / or replacement) in regions C or C 'or B or B', still preserves the loop terminal of the loop rod. In some embodiments, any modification of at least one nucleotide (for example, a deletion, insertion and / or substitution) between C and C 'and / or B and B' retains three sequential T nucleotides (ie , TTT) in at least one cycle terminal.
[00136] [00136] In one embodiment, the nucleotide sequence of the structural element can be modified (for example, by modifying 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or more nucleotides or any strip in between) to produce a modified structural element. In one embodiment, specific modifications for ITRs are exemplified in this document (for example, SEQ ID NO: 2, 52, 63, 64, 101-499, or 545-547). In some embodiments, an ITR can be modified (for example, by modifying 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or more nucleotides or any strip in between). In other modalities, the ITR can have at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more of sequence identity with one of the modified ITRs of SEQ ID NO: 469-499 or 545-547, or the RBE-containing section of arm A-A 'and arms C-C' and B-B 'of SEQ ID NO: 101-134 or 545-547.
[00137] [00137] In some embodiments, a modified ITR may for example comprise the removal or deletion of an entire particular arm, for example, all or part of the arm A-A ', or all or part of the arm B B-' or all or part of the arm C-C ', or, alternatively, the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs that form the handle shank since the handle end cap that covers the stem (for example, single arm) is still present (for example, see ITR-6). In some embodiments, a modified ITR may comprise removing 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from the B-B 'arm. In some embodiments, a modified ITR may comprise the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from the C-C 'arm. In some embodiments, a modified ITR may comprise removing 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from the C-C 'arm and removing 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs of arm B-B '. Any combination of base pair removal is provided, for example, 6 base pairs can be removed from arm C-C 'and 2 base pairs from arm B-B'.
[00138] [00138] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9 or more complementary base pairs are removed from each one between portion C and portion C 'of loop C-C' so that the arm C-C 'is truncated. That is, if a base is removed in the C portion of a C-C 'arm, the complementary base pair in the C' portion is removed, thereby truncating the C-C 'arm. In such embodiments, 2, 4, 6, 8 or more base pairs are removed from the C-C 'arm so that the C-C' arm is truncated. In alternative embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs are removed from the C portion of an arm C-C 'so that only the C' portion of the arms remains. In alternative modes, 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs are removed from the C 'portion of a C-C' arm so that only the C portion the arms remain.
[00139] [00139] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9 or more complementary base pairs are removed from each of portion B and portion B 'of arm B-B' so that the BB's arm is truncated. That is, if a base of is removed in the B portion of the B-B 'arm, the complementary pair of bases in the B' portion is removed, thereby truncating the B-B 'arm. In such embodiments, 2, 4, 6, 8 or more base pairs are removed from the B-B 'arm so that the B-B' arm is truncated. In alternative embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs are removed from portion B of the arm B-B 'so that the single portion B' of the arms remains. In alternative modalities, 1, 2, 3, 4, 5, 6, 7, 8, 9 or more pairs of bases are removed from the B 'portion of the B-B' arm so that the single B portion of the arms remains .
[00140] [00140] In some modalities, a modified ITR can have between 1 and 50 (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50) nucleotide deletions in relation to a full-length wild-type ITR sequence. In some embodiments, a modified ITR may have between 1 and 30 deletions of nucleotides in relation to a full-length WT ITR sequence. In some modalities, a modified ITR has between 2 and 20 deletions of nucleotides in relation to a full-length wild-type ITR sequence.
[00141] [00141] In some embodiments, a modified ITR forms two opposing rod-handles, of asymmetrical length, for example, handle C-C 'has a different length for handle B-B'. In some modalities, one of the longitudinally-asymmetrical opposing handle stems of a modified ITR has a portion of stem C-C 'and / or B-B' in the range of 8 to 10 base pairs in length and one loop portion (for example, between C-C 'or between B-B') with 2 to 5 unpaired deoxyribonucleotides. In some embodiments, a handle asymmetric in length from a modified ITR has a portion of the stem C-C 'and / or B-B' less than 8, or less than 7, 6, 5, 4, 3, 2, 1 of base pairs in length and a loop portion (for example, between C-C 'or between B-B') having between 0 to 5 nucleotides. In some modalities, a modified ITR with a stem-structure
[00142] [00142] In some embodiments, a modified ITR does not contain any nucleotide deletions in the RBE-containing portion of regions A or A ', so as not to interfere with DNA replication (eg, binding to an RBE by Rep protein, or nicking at a terminal resolution site). In some embodiments, a modified ITR covered for use in this document has one or more deletions in regions B, B ', C and / or C, as described in this document. Several non-limiting examples of modified ITRS are shown in Figures 9A-26B.
[00143] [00143] In some modalities, a modified ITR may comprise a deletion of the B-B 'from the arm, so that the C-C' arm remains, for example, see the example of ITR-2 (left) and ITR-2 (to the right) shown in Figures 9A-9B and ITR-4 (left) and ITR-4 (right) (Figures, 11A-11B). In some embodiments, a modified ITR may comprise a deletion of the arm C-C 'so that the arm B-B' remains, for example, see the example of ITR-3 (left) and ITR-3 ( shown in Figure 10A-10B. In some embodiments, a modified ITR may comprise a deletion of the B-B 'arm and the C-C' arm so that a single loop-rod remains, for example, see the ITR-6 example (left) and ITR-6 (right) shown in Figure 14A-14B and ITR-21 and ITR-
[00144] [00144] In some modalities, a modified ITR may comprise a deletion of base pairs, in any one or more among: portion C, portion C ', portion B or portion B', so that matching complementary base occurs between portions C-B 'and portions C'-B to produce a single arm, for example, see ITR-10 (right) and ITR-10 (left) (Figure 12A-12B).
[00145] [00145] In some embodiments, in addition to a modification in one or more nucleotides in regions C, C ', B and / or B', a modified ITR for use in this document may comprise a modification (for example, deletion, substitution or addition) of at least 1, 2, 3, 4, 5, 6 nucleotides in any one or more of the regions selected from: between A 'and C, between C and C', between C 'and B , between B and B 'and between B' and A. For example, the nucleotide between B 'and C in a modified right ITR can be replaced from an nA to a G, C or A or deleted or one or more nucleotides added; a nucleotide between C 'and B in a modified left ITR can be changed from a T to a G, C or A or deleted or one or more nucleotides added.
[00146] [00146] In certain embodiments of the present invention, the ceDNA vector that does not have a modified ITR consists of the nucleotide sequence selected from any one of: SEQ ID NO: 550-557. In certain embodiments of the present invention, the ceDNA vector that does not have a modified ITR comprises the nucleotide sequence selected from any one of: SEQ ID NO: 550-557.
[00147] [00147] In some embodiments, the ceDNA vector comprises a regulatory switch as described in this document and a selected modified ITR that has the nucleotide sequence selected from any of the group consisting of: SEQ ID NO: 550-557 .
[00148] [00148] In another modality, the structure of the structural element can be modified. For example, the structural element changes the height of the stem and / or the number of nucleotides in the handle. For example, the height of the rod can be about 2, 3, 4, 5, 6, 7, 8 or 9 nucleotides or more or any range therein. In one embodiment, the stem height can be from about 5 nucleotides to about 9 nucleotides and functionally interacts with Rep. In another embodiment, the stem height can be about 7 nucleotides and interacts functionally with Rep. In another example , the loop can be 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides or more or any range in that.
[00149] [00149] In another embodiment, the number of GAGY binding sites or GAGY related binding sites in the RBE or in the extended RBE can be increased or decreased. In one example, the extended RBE or RBE can comprise 1, 2, 3, 4, 5 or 6 or more GAGY binding sites or any gap therein. Each GAGY binding site can independently be an exact GAGY sequence or a GAGY-like sequence, as long as the sequence is sufficient to bind a Rep protein.
[00150] [00150] In another modality, the spacing between two elements (such as, without limitation, the RBE and a hairpin) can be changed (for example, increased or decreased) to alter the functional interaction with a large Rep protein. For example, the spacing can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides or more or any range in that.
[00151] [00151] The ceDNA vector described here may include an ITR structure that is modified in relation to the wild type ITR AAV2 structure disclosed here, but still maintains an operational portion of RBE, trs and RBE. Figures 2A and 2B show a possible mechanism for the operation of a three-site within a portion of the wild-type ITR structure of a ceDNA vector. In some modalities
[00152] [00152] In some embodiments, a ceDNA vector that does not have a modified ITR selected from any sequence consisting of, or consisting essentially of: SEQ ID NO: 500-529, as provided herein. In some embodiments, a ceDNA vector that does not have an ITR is selected from any selected sequence of SEQ ID NO: 500-529.
[00153] [00153] In some modalities, the modified ITR (for example, the left or right ITR) of the ceDNA vector described here has changes in the loop arm, the truncated arm or the spacer. Exemplary sequences of ITRs with modifications to the loop arm, truncated arm or spacer are listed in Table 2.
[00154] [00154] In some modalities, the modified ITR (for example, the left or right ITR) of the ceDNA vector described here has modifications within the loop arm and the truncated arm. Exemplary sequences of ITRs with changes in the loop arm and truncated arm are listed in Table 3.
[00155] [00155] In some modalities, the modified ITR (for example, the left or right ITR) of the ceDNA vector described here has modifications within the handle arm and the spacer. Exemplary sequences of ITRs with modifications to the loop arm and spacer are listed in Table 4.
[00156] [00156] In some modalities, the modified ITR (for example, the left or right ITR) of the ceDNA vector described here has changes in the truncated arm and the spacer. Exemplary sequences of ITRs with modifications to the truncated arm and spacer are listed in Table 5.
[00157] [00157] In some modalities, the modified ITR (for example, the left or right ITR) of the ceDNA vector described here has changes in the loop arm, the truncated arm and the spacer. Exemplary sequences of ITRs with modifications to the loop arm, truncated arm and spacer are listed in Table 6.
[00158] [00158] In some modalities, the ITR (for example, the left or right ITR) is modified so that it comprises the lowest deployment energy ("low energy structure"). A low energy will have reduced Gibbs free energy compared to a wild type ITR. Exemplary sequences of ITRs that are modified to low (ie, reduced) deployment energy are shown here in Tables 7 to 9.
[00159] [00159] In some modalities, the modified ITR is selected from any one or a combination of those shown in Tables 2-9, 10A or 10B.
[00160] [00160] Table 2: ITR sequences with changes in the handle arm, truncated arm or spacer. This includes the RBS sequence GCGCGCTCGCTCGCTC (SEQ ID NO: 531) at the 5 'end and the complementary RBE sequence GAGCGAGCGAGCGCGC (SEQ ID NO: 536) at the 3' end. Table 2 SEQ Region modified - Sequence ΔG No. Es- ID each tract 135 Truncated arm GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGT -73.6 1 CGCCCGAAGCCCGGGCTGCCTCAGTGAGCGAGCGAGCGC
[00161] [00161] Table 3: Modified ITR sequences with modifications in Loop Arm and Truncated Arm Table 3 SEQ No. Es- Modified Region Sequence ΔG Traction ID 234 Loop Arm & GCGCGCTCGCTCGCTCACTGAGGCCAGGCGAC- -72.2 Truncated Arm CAAAGGTCGGGGGCAGGGGC 2235 GCGCGCTCGCTCGCTCACTGAGGCCAGGCGAC- CAAAGGTCGCCTGACGCCATGGCGGCCTCAG- -73.7 -71.8 TGAGCGAGCGAGCGCGC 1236 GCGCGCTCGCTCGCTCACTGAGGCCAGGCGAC- CAAAGGTCGCCTGACGACATGTCGGCCTCAG- TGAGCGAGCGAGCGCGC 1 237 GCGCGCTCGCTCGCTCACTGAGGCCAGGCGAC- CAAAGGTCGCCTGACGAACGTTCGGCCTCAG- -72.2 -72.6 TGAGCGAGCGAGCGCGC 1238 GCGCGCTCGCTCGCTCACTGAGGCCAGGCGAC- CAAAGGTCGCCTGAAGCAATTGCTGCCTCAG- TGAGCGAGCGAGCGCGC 1 239 -75 GCGCGCTCGCTCGCTCAC- , 8
[00162] [00162] Table 4: ITR sequences with modifications to the handle arm and Spacer Region modi- Table 4 Sequence SEQ ΔG Es- Got ID No. ture handle arm 264 -71.4 GCGCGCTCGCTCGCTCACTAAGGCCAGGCGACCAAAGGTCGCCTG 1 & ACGCCCGGGCGGCCTTAGTGAGCGAGCGAGCGCGC Spacer 265 -75 2 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGGCCAAAGGCCGCC
[00163] [00163] Table 5: ITR sequences with modifications to the truncated arm and spacer Table 5
[00164] [00164] Table 6: ITR sequences with modifications in the loop arm, truncated arm and spacer Table 6 SEQ Modified Region Sequence ΔG No. Es- structure ID 319 Loop arm, GCGCGCTCGCTCGCTCACTAAGGCCAGGCGACCAAAG -69.9 2 Truncated arm & GTCGCCGGGGGCGGGCGGGC -71.4 1 GTCGCCTGACGCCATGGCGGCCTTAGTGAGCGAGCGAG
[00165] [00165] As described in this document, the modified ITR can be generated to include deletion, insertion or replacement of one or more nucleotides of the wild type ITR derived from the AAV genome. The modified ITR can be generated by genetic modification during propagation in a plasmid in Escherichia coli or as a baculovirus genome in Spodoptera frugiperda cells, or other biological methods, for example, in vitro, using reaction in polymerase or chemical synthesis.
[00166] [00166] In some embodiments, the modified ITR includes deletion, insertion or replacement of one or more nucleotides from the wild-type AAV2 ITR (left) (SEQ ID NO: 51) or the wild-type AAV2 ITR (right) ) (SEQ ID NO: 1). Specifically, one or more nucleotides are deleted, inserted or substituted from B-C 'or C-C' from the T-shaped rod-loop structure. In addition, the modified ITR does not include modification of the Rep-binding elements (RBE) and at the terminal resolution site (three) of the wild-type AAV2 ITR, although the RBE '(TTT) may or may not be present, depending on whether the model has undergone a round of replication, converting thus having the AAA triplet in complementary RBE'-TTT.
[00167] [00167] Three types of modified ITRs are exemplified - (1) a modified ITR with a lower energy structure that comprises a single arm and a single unpaired loop ("single arm / single loop paired"); (2) a modified ITR with a lower energy structure with a single hairpin ("single hairpin structure"); and (3) a modified ITR with a lower energy structure with two arms, one of which is truncated ("truncated structure").
[00168] [00168] ITR modified with a single arm / unpaired loop structure
[00169] [00169] The wild type ITR can be modified to form a secondary structure comprising a single arm and a single unpaired loop (ie, "single arm structure / single paired loop"). The Gibbs free energy (ΔG) of the structure split can vary between -85 kcal / mol and -70 kcal / mol. Examples of modified ITR structures are provided.
[00170] [00170] The modified ITRs envisaged to form the single-arm / unpaired loop structure may include deletion, insertion or replacement of one or more nucleotides from the wild-type ITR in the sequences that form arm B and B 'and / or arm C and C '. The modified ITR can be generated by genetic modification or biological and / or chemical synthesis.
[00171] [00171] For example, ITR-2, left and right provided in Figures 9A-9B (SEQ ID NO: 101 and 102), are generated to have two nucleotide deletion from the C-C 'arm and 16 nucleotide deletion arm B-B 'in the wild type AAV2 ITR. Three nucleotides remaining in the modified ITR's B-B 'arm do not make a complementary match. Thus, the left and right ITR-2 have the smallest energy structure with a single C-C 'arm and a single unpaired loop. Gibbs free energy in the unfolding of the structure is expected to be about -72.6 kcal / mol.
[00172] [00172] Left and right ITR-3 provided in Figures 10A and 10B (SEQ ID NO: 103 and 104), are generated to include 19 deletions of numbers
[00173] [00173] Left and right ITR-4 provided in Figures 11A and 11B (SEQ ID NO: 105 and 106), are generated to include 19 deletions of nucleotides in the B-B 'arm of the wild-type AAV2 ITR. Three remaining nucleotides in the modified ITR's B-B 'arm do not make a complementary pairing. Thus, the left and right ITR-4 have the smallest energy structure with a single C-C 'arm and a single unpaired loop. Gibbs free energy in the structure unfold is expected to be about -76.9 kcal / mol.
[00174] [00174] Left and right ITR-10 provided in Figures 12A and 12B (SEQ ID NO: 107 and 108), are generated to include 8 deletions of nucleotides in the B-B 'arm of the wild-type AAV2 ITR. The nucleotides that remain in arms B-B 'and C-C' make new complementary connections between motifs B and C '(ITR-10 on the left) or between motifs C and B' (ITR-10 at right). Thus, the left and right ITR-10 have the smallest energy structure with a single B-C 'or C-B' arm and a single unpaired loop. Gibbs free energy in the unfolding of the structure is expected to be about -83.7 kcal / mol.
[00175] [00175] Left and right ITR-17 provided in Figures 13A and 13B (SEQ ID NO: 109 and 110), are generated to include 14 deletions of nucleotides in the C-C 'arm of the wild-type AAV2 ITR. Eight remaining nucleotides in the C-C 'arm do not make complementary connections. As a result, the left and right ITR-17 have the smallest energy structure with a single B-B ’arm and a single non-clamping loop.
[00176] [00176] The left or right wild type ITR sequences (top) and several left or right modified ITRs (below) predicted to form the single-arm / loop-free structure are aligned and provided below in Table 7.
[00177] [00177] Table 7: Alignment of ITT WT and modified ITRs (ITR-2, ITR-3, ITR-4, ITR-10 and ITR-17) with a single arm / loop unpaired structure. TABLE 7 Sequence alignment of wild type ITRs; ITR WT-L (SEQ ID ITR Modified NO: 540) or ITR WT-R (SEQ ID NO: 17) (top sequence) v. modified ITR ΔG (kcal / (SEQ ID NO) sequences (SEQ ID NO: 101, 102, 103, 104, 105, 106, 107, 108, 109, mol) 110) (background sequences)) ITR-2 Left -72.6 (SEQ: 101) ITR-2 Right -72.6 (SEQ: 102) ITR-3 Left -74.8 (SEQ: 103) ITR-3 Right -74.8 (SEQ: 104)
[00178] [00178] The wild type ITR can be modified to have the lowest energy structure that comprises a single hook structure. The Gibbs free energy (ΔG) of the structure split can vary between -70 kcal / mol and -40 kcal / mol. Exemplary structures of the modified ITRs are provided in Figures 14A and 14B.
[00179] [00179] The modified ITRs envisaged to form the only hairpin structure may include the deletion, insertion or replacement of one or more nucleotides of the wild type ITR in the sequences that form arm B and B 'and / or arm C and C '. The modified ITR can be generated by genetic modification or biological and / or chemical synthesis.
[00180] [00180] For example, left and right ITR-6 provided in Figures 14A and 14B (SEQ ID NO: 111 and 112), includes 40 deletions of nucleotides in the ITR B-B 'and C-C' arms wild-type AAV2. The remaining nucleotides in the modified ITR are expected to form a single hairpin structure. The Gibbs free energy of the structure split is about -54.4 kcal / mol.
[00181] [00181] The wild type and ITR-6 (left and right) sequences are aligned and are provided below in Table 8.
[00182] [00182] Table 8: Alignment of ITT WT and ITR-6 modified with a single hook structure. TABLE 8 Sequence alignment of wild type ITRs; ITR WT-L Modified ITR (SEQ ID NO: 540) or ITR WT-R (SEQ ID NO: 17) (ΔG sequence (kcal / (SEQ ID NO) top)) v. Modified ITR-6 (SEQ ID NO: 111; ITR-6, left) (SEQ mol) ID NO: 112, ITR-6 right) (background sequence) ITR-6 Left -54.4 (SEQ: 111)
[00183] [00183] The wild type ITR can be modified to have the lowest energy structure comprising two arms, one of which is truncated. The free Gibbs energy (Δ G) of the split varies between -90 and -70 kcal / mol. Thus, their free Gibbs unfold energies are lower than the wild type ITR of AAV2.
[00184] [00184] The modified ITRs may include deletion, insertion or replacement of one or more nucleotides of the wild type ITR in the sequences that form the B and B 'arm and / or the C and C' arm. In some embodiments, a modified ITR may, for example, comprise the removal of an entire particular loop, for example, loop A-A ', loop B-B' or loop C-C 'or, alternatively, the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs that form the handle stem, as long as the final handle at the end of the stem is still present. The modified ITR can be generated by genetic modification or biological and / or chemical synthesis.
[00185] [00185] Exemplary structures of modified ITRs with a truncated structure are provided in Figures 15A-15B.
[00186] [00186] The sequences of several modified ITRs predicted to form a truncated structure are aligned with a wild type ITR sequence and given below in Table 9.
[00187] [00187] Table 9: Alignment of ITT WT and modified ITRs (ITR-
[00188] [00188] Additional exemplary modified ITRs in each of the above classes for use in this document are provided in Tables 10A and 10B. The expected secondary structure of the modified ITRs on the right in Table 10A is shown in Figure 26A, and the structure
[00189] [00189] Tables 10A and 10B show modified ITRs on the right and exemplary left.
[00190] [00190] Table 10A: Example modified ITRs. Such exemplified modified ITRs may comprise the GCGCGCTCGCTCGCTC-3 'RBE (SEQ ID NO: 531), AC-TGAGGC spacer (SEQ ID NO: 532), the GCCT-CAGT spacer complement (SEQ ID NO: 535) and RBE '(i.e., complement to RBE) of GAGCGAGCGAGCGCGC (SEQ ID NO: 536). Table 10A: Modified ITRs Exemplifying Rights Construct Sequence SEQ ITR ID NO: ITR-18 AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCG- 469 Right CTCGCTCACTGAGGCGCACGCCCGGGTG
[00191] [00191] TABLE 10B: Example modified ITRs on the left. These modified left modified ITRs may comprise the GCGCGCTCGCTCGCTC-3 'RBE (SEQ ID NO: 531), ACTGAGGC spacer (SEQ ID NO: 532), the GCCTCAGT spacer complement (SEQ ID NO: 535) and the RBE complement (RBE ') of GAGCGAGCGAGCGCGC (SEQ ID NO: 536). Table 10B: modified left ITR-ITR exemplifying CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGA- 33 AACCCGGGCGTGCGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGA- left ITR-GTGGCCAACTCCATCACTAGGGGTTCCT 484 CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGTCGGG- 34 CGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCA- left ITR-GAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 485 CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGG- 35 CAAAGCCCGGGCGTCGGCCTCAGTGAGCGAGCGAGCGCGCA- left ITR-GAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 486 CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCGCCCGGGCG- 36 TCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCG- left ITR CAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 487 CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCAAAGCCTCAG- -37 TGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCAC- Left TAGGGGTTCCT 488 ITR-38 CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGGGGGGGCGG
[00192] [00192] In the embodiments of the present invention, the ceDNA vector described in this document does not have ITRs modified with the nucleotide sequence selected from any of the groups in SEQ ID NO: 550, 551, 552, 553, 553, 554 , 555, 556, 557.
[00193] [00193] As the ceDNA vector has a modified ITR that has one of the modifications in region B, B ', C or C', as described in SEQ ID NO: 550-557, as defined in any or more of the claims in this application or within any invention to be defined in amended claims that may in the future be filed with this application or any patent derived therefrom, and insofar as the laws of any relevant country or countries to which that or if those claims apply, we reserve the right to refuse said description of the claims in this application or any patent derived therefrom, to the extent necessary to prevent the invalidation of this application or any patent derived therefrom.
[00194] [00194] For example, and without limitation, we reserve the right to refuse any of the following matters from any claim in this application, now or as amended in the future, or any patent derived therefrom:
[00195] [00195] A. a modified ITR selected from any group consisting of: SEQ ID NO: 2, 52, 63 64, 113, 114, 550, 551; 552, 553, 553, 554, 555, 556, 557 used in a ceDNA vector without a regulating switch
[00196] [00196] B. the modified ITRs specified above in A., in a ceDNA vector without regulatory sequence and in which the heterologous nucleic acid encodes ABCA4, USA2A var1, VEGFR, CEP290, factor VIII BDD (FVIII), factor VIII, vWF_His , vWF, lecithin cholesterol acetyl transferase, PAH, G6PC or CFTR
[00197] [00197] Without limitation, we affirm that the reservation above a right of disclaimer applies at least to claims 1 to 57 of this request and to all paragraphs, including, without limitation, paragraphs established in [0027] and [00397]. IV Regulatory elements.
[00198] [00198] The ceDNA vectors can be produced from expression constructs that further comprise a specific combination of cis regulatory elements. The cis regulatory elements include, without limitation, a promoter, a ribosome switch, an isolator, a mir adjustable element, a post-transcriptional regulatory element, a tissue and cell type specific promoter and an intensifier. In some modalities, ITR can act as the promoter of the transgene. In some embodiments, the ceDNA vector comprises additional components to regulate the expression of the transgene, for example, regulatory switches, as described herein, to regulate the expression of the transgene, or an extermination switch, which can kill a cell it buys - end the ceDNA vector.
[00199] [00199] ceDNA vectors can be produced from expression constructs that further comprise a specific combination of cis regulatory elements, such as the post-transcriptional regulatory element WHP (WPRE) (for example, SEQ ID NO: 8) and BGH polyA (SEQ ID NO: 9) Expression cassettes suitable for use in expression constructs are not limited by the packaging restriction imposed by the viral capsid. The expression cassettes of the present invention include a promoter, which can influence general levels of expression, as well as cell specificity. For the expression of the transgene, they may include an immediate early promoter derived from a highly active virus. The expression cassettes can contain tissue-specific eukaryotic promoters to limit the expression of the transgene to specific cell types and to reduce toxic effects and immune responses resulting from unregulated ectopic expression. In preferred embodiments, an expression cassette may contain a synthetic regulating element, such as a CAG promoter (SEQ ID NO: 3). The CAG promoter comprises (i) the early cytomegalovirus (CMV) enhancing element, (ii) the promoter, the first exon and the first intron of the chicken beta-actin gene and (iii) the acceptor splicing of the rabbit beta-globin gene. Alternatively, an expression cassette may contain an alpha-1-antitrypsin (AAT) promoter (SEQ ID NO: 4 or SEQ ID NO: 74), a liver-specific promoter (LP1) (SEQ ID NO: 5 or SEQ ID AT THE:
[00200] [00200] Suitable promoters, including those described above, can be derived from viruses and, therefore, can be referred to as viral promoters, or can be derived from any organism, including prokaryotic or eukaryotic organisms. Suitable promoters can be used to target expression by any RNA polymerase (for example, pol I, pol II, pol III). Exemplifying promoters include, without limitation, initial SV40 promoter, long terminal repeat (LTR) promoter of the mouse mammary tumor virus; major late adenovirus promoter (Ad MLP); a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter, such as the CMV immediate promoter region (CMVIE), a rous sarcoma virus (RSV) promoter, a small human U6 nuclear promoter ( U6, for example, SEQ ID NO: 18) (Miyagishi et al., Nature Biotechnolog y 20, 497-500 (2002)), an enhanced U6 promoter (for example, Xia et al., Nucleic Acids Res. Res 2003 September 1, 2003; 31 (17)), a human H1 (H1) promoter (for example, SEQ ID NO: 19), a CAG promoter, a human alpha 1-antitipsin (HAAT) promoter (for example, SEQ ID NO: 21) and the like. In the modalities, these promoters are altered at the end containing the downstream intron to include one or more nuclease cleavage sites. In embodiments, the DNA containing the nuclease cleavage site (or sites) is foreign to the promoter DNA.
[00201] [00201] A promoter may comprise one or more specific transcriptional regulatory sequences to further improve expression and / or alter its spatial and / or temporal expression. A promoter can also comprise distal enhancing or repressing elements, which can be located up to several thousand base pairs from the initial transcription site. A promoter can be derived from sources including viruses, bacteria, fungi, plants, insects and animals. A promoter can regulate the expression of a component of the gene in a constitutive or differential manner in relation to the cell, tissue or organ in which the expression occurs or, in relation to the stage of development in which the expression occurs, or in response to external stimuli, such as physiological stresses, pathogens, metal ions or inducing agents. Representative examples of promoters include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator, tac promoter, SV40 final promoter, SV40 initial promoter, SV40 initial promoter, RSV-LTR promoter, CMV IE promoter, SV40 initial promoter or SV40 final promoter and the CMV IE promoter, as well as the promoters listed below. Such promoters and / or enhancers can be used to express any gene of interest, for example, gene editing molecules, donor sequence, therapeutic proteins, etc.). For example, the vector may comprise a promoter that is operably linked to the nucleic acid sequence that encodes a therapeutic protein. The promoter operationally linked to the therapeutic protein coding sequence may be a promoter of the simian virus 40 (SV40), a promoter of the mouse mammary tumor virus (MMTV), a promoter of the human immunodeficiency virus (HIV), as the bovine immunodeficiency virus (BIV) terminal repeat promoter (LTR), a promoter of the Moloney virus, a promoter of the avian leukosis virus (ALV), a cytomegalovirus (CMV) promoter, as the immediate CMV promoter, the Epstein Barr virus (EBV) promoter or a Rous sarcoma virus (RSV) promoter. The promoter can also be a promoter for a human gene, such as human ubiquitin C (hUbC), human actin, human myosin, human hemoglobin, human muscle creatine or human metallothionein. The promoter can also be a tissue-specific promoter, such as a liver-specific promoter, such as human alpha 1-antitipsin (HAAT), natural or synthetic. In one embodiment, delivery to the liver can be achieved using the specific ApoE targeting of the composition that comprises a vector of ceDNA for hepatocytes through the low density lipoprotein (LDL) receptor present on the surface of the hepatocyte.
[00202] [00202] In one embodiment, the promoter used is the native promoter of the gene encoding the therapeutic protein. Promoters and other regulatory sequences for the respective genes encoding therapeutic proteins are known and have been characterized. The promoter region used may further include one or more additional regulatory sequences (for example, native), for example, enhancers (for example, SEQ ID NO: 22 and SEQ ID NO: 23).
[00203] [00203] Non-limiting examples of promoters suitable for use in accordance with the present invention include the CAG promoter, for example (SEQ ID NO: 3), the HAAT promoter (SEQ ID NO: 21), the human EF1- α promoter (SEQ ID NO: 6) or a fragment of the EF1a promoter (SEQ ID NO: 15), IE2 promoter (for example, SEQ ID NO: 20) and the rat EF1- α promoter (SEQ ID NO: 24) .
[00204] [00204] Polyadenylation sequences: a sequence encoding a polyadenylation sequence can be included in the ceDNA vector to stabilize the mRNA expressed from the ceDNA vector and to assist in nuclear export and translation. In one embodiment, the ceDNA vector does not include a polyadenylation sequence. In other modes, the vector includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 25 at least 30, at least 40, at least 45, at least 50 or more adenine dinucleotides. In some embodiments, the polyadenylation sequence comprises about 43 nucleotides, about 40-50 nucleotides, about 40-55 nucleotides, about 45-50 nucleotides, about 35-50 nucleotides or any interval in between.
[00205] [00205] Expression cassettes may include a polyadenylation sequence known in the art or a variation thereof, such as a naturally occurring isolated sequence of bovine BGHpA (for example, SEQ ID NO: 74) or an SV40pA virus (for example, example, SEQ ID NO: 10) or a synthetic sequence (for example, SEQ ID NO: 27). Some expression cassettes may also include the enhanced polyA SV40 late signal sequence (USE). In some embodiments, USE can be used in combination with SV40pA or heterologous poly-A signal.
[00206] [00206] Expression cassettes can also include a post-transcriptional element to increase the expression of a transgene. In some embodiments, the post-transcriptional regulatory element (WPRE) of the groundhog hepatitis virus (WHP) (for example, SEQ ID NO: 8) is used to increase the expression of a transgene. Other post-transcriptional processing elements can be used, such as the post-transcriptional element of the herpes simplex virus thymidine kinase gene or the hepatitis B virus (HBV). Secretory sequences can be linked to transgenes, for example, VH-02 and VK-A26 sequences, for example, SEQ ID NO: 25 and SEQ ID NO: 26.
[00207] [00207] A molecular regulatory switch is one that generates a measurable change of state in response to a signal. Such regulatory switches can be usefully combined with the ceDNA vectors described herein to control the output of the ceDNA vector. In some embodiments, the ceDNA vector comprises a regulatory switch that serves to adjust the expression of the transgene. For example, it can serve as a biocontainment function for the ceDNA vector. In some embodiments, the switch is a "LIGA / OFF" switch designed to start or stop (ie, turn off) the expression of the gene of interest in the ceDNA in a controllable and adjustable manner. In some embodiments, the switch may include an "extermination switch" that can instruct the cell comprising the ceDNA vector to undergo programmed cell death once the switch is activated. A. Binary regulatory switches
[00208] [00208] In some embodiments, the ceDNA vector comprises a regulatory switch that can serve to modulatively control the expression of the transgene. In such an embodiment, the expression cassette located between the ITRs of the ceDNA vector can additionally comprise a regulatory region, for example, a promoter, cis element, repressor, intensifier etc., which is operationally connected to the gene of interest, in which the regulatory region is regulated by one or more cofactors or exogenous agents. Therefore, in one modality, only when one or more cofactors or exogenous agents are present in the cell will the transcription and expression of the gene of interest of the ceDNA vector occur. In another embodiment, one or more cofactors or exogenous agents can be used to suppress the transcription and expression of the gene of interest.
[00209] [00209] Any nucleic acid regulatory region known to a person skilled in the art can be employed in a ceD-NA vector designed to include a regulatory switch. Just as an example, regulatory regions can be modulated by small molecule switches or inducible or repressible promoters. Non-limiting examples of inducible promoters are hormone-inducible or metal-inducible promoters. Other exemplary inducible promoter / enhancer elements include, without limitation, an RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter and a metallothionein promoter. Classic tetracycline-based or other antibiotic-based switches are covered for use, including those described in (Fussenegger et al., Nature Biotechnol. 18: 1203-1208 (2000)). B. Small molecule regulatory switches
[00210] [00210] A variety of regulatory switches based on small molecules known in the art are known in the art and can be combined with the ceDNA vectors described herein to form a regulatory switch-controlled ceDNA vector. In some embodiments, the regulatory switch can be selected from any one or a combination of: an orthogonal ligand / nuclear receptor pair, for example, retinoid receptor / lG335 and GRQCIMFI variant, together with an artificial promoter that controls the expression of the operably linked transgene, as described in Taylor et al. BMC Biotechnology 10 (2010): 15; steroid receptors manipulated, for example, progesterone receptor modified with a C-terminal truncation that cannot bind progesterone, but binds to RU486 (mifepristone) (US Patent 5,364,791); a Drosophila ecdysone receptor and its ecdysteroid ligands (Saez, et al, PNAS, 97 (26) (2000), 14512-14517 ;. or an antibiotic-controlled switch trimethoprim (TMP), as described in
[00211] [00211] Other regulatory switches based on small molecules, known to a person skilled in the art, are also intended for use in the control of transgenic expression of ceDNA and include, but are not limited to those described in Buskirk et al., Cell ; Chem and Biol., 2005; 12 (2); 151-161; an LIGA switch sensitive to abscisic acid; as described in Liang, F.-S., et al., (2011) Science Signaling, 4 (164); exogenous L-arginine sensitive LIGA switches, such as those described in Hartenbach, et al. Nucleic Acids Research, 35 (20), 2007, synthetic LIGA switches sensitive to bile acids, such as those described in Rössger et al., Metab Eng. 2014, 21: 81–90; biotin sensitive LIGA switches, such as those described in Weber et al., Metab. Eng. Mar 2009; 11 (2): 117-124; dual input food additive benzoate / vanillin sensitive switchgear, as described in Xie et al., Nucleic Acids Research, 2014; 42 (14); e116; Switches sensitive to 4-hydroxy tamoxifen, such as those described in Giuseppe et al., Molecular Therapy, 6 (5), 653-663; and flavinoid-sensitive regulatory co-mutators (floretine), such as those described in Gitzinger et al., Proc. Natl. Acad. Sci. U S A. 2009 Jun 30; 106 (26): 10638-10643.
[00212] [00212] In some embodiments, the regulatory switch to control the transgene or expressed by the ceDNA vector is a pro-drug activation switch, such as that disclosed in US patents 8,771,679 and
[00213] [00213] Exemplary regulatory switches for use in ceDNA vectors include, without limitation in Table 11. C. "Access code" regulatory switches
[00214] [00214] In some modalities, the regulating switch can be an "access code switch" or "access code circuit". Access code switches allow fine adjustment of the control of transgene expression from the ceDNA vector when specific conditions occur - that is, a combination of conditions must be present for the expression and / or repression of the transgene .
[00215] [00215] Access code regulatory switches are useful for adjusting the expression of the transgene from the ceDNA vector. For example, the access code regulating switch may be modular in that it comprises multiple switches, for example, a tissue-specific inducible promoter that is activated only in the presence of a certain level of a metabolite. In such a fashion, for the expression of the transgene of the ceDNA vector to occur, the inducible agent must be present (condition A), in the desired cell type (condition B) and the metabolite is at, above or below a certain threshold (Condition C). In alternative modalities, the access code regulating switch can be manipulated so that the expression of the transgene is activated when conditions A and B are present, but will be deactivated when condition C is present. Such a modality is useful when Condition C occurs as a direct result of the expressed transgene - that is, Condition C serves as a positive response to the loop to disable the transgene expression of the ceDNA vector when the transgene has had a sufficient amount of therapy. desired effect.
[00216] [00216] In some embodiments, an access code regulating switch covered for use in the ceDNA vector is described in WO2017 / 059245, which describes a switch called "access code switch" or "code circuit of access "or" access code extermination switch "which is a synthetic biological circuit that uses hybrid transcription factors (TFs) to build complex environmental requirements for cell survival. The access code regulating switches described in WO2017 / 059245 are particularly useful for use in
[00217] [00217] In some embodiments, an access code regulatory switch or "access code circuit" covered for use in the ceDNA vector comprises hybrid transcription factors (TFs) to expand the range and complexity of environmental signals used - to define biocontainment conditions. Unlike the deadman switch that triggers cell death in the presence of a predetermined condition, the "access code circuit" allows the cell to survive or transgene expression in the presence of an "access code" "specific and can be easily reprogrammed to allow transgene expression and / or cell survival only when the predetermined environmental condition or access code is present.
[00218] [00218] In one aspect, an "access code" system that restricts cell growth to the presence of a predetermined set of at least two selected agents, includes one or more nucleic acid constructs that encode expression modules comprising : i) a toxin expression module that encodes a toxin that is toxic to a host cell, in which the sequence that encodes the toxin is operationally linked to a P1 promoter that is repressed by the binding of a first hy-
[00219] [00219] Consequently, a ceDNA vector may comprise an ‘access code regulatory circuit’ that requires the presence and / or absence of specific molecules to activate the output module. In some embodiments, in which genes encoding cell toxins are placed in the output module, this access code access code regulator circuit cannot be used just to regulate the expression of the transgene, but it can also be used to create an interruption mechanism in which the circuit kills the cell if the cell behaves in an undesired manner (for example, it leaves the specific environment defined by the sensor domains or differentiates into a different cell type). In a non-limiting example, the modularity of hybrid transcription factors, the circuit architecture and the output module allow the circuit to be reconfigured to detect other environmental signals, react to environmental signals.
[00220] [00220] Any and all combinations of regulatory switches described in this document, for example, small molecule switches, nucleic acid based switches, small molecule-nucleic acid hybrid switches, post-transcriptional transgene regulation switches , post-translational regulation, radiation controlled switches, hypoxia-mediated switches and other regulatory switches known to persons skilled in the art as described in this document can be used in an access code regulatory switch, as described herein. document. Regulatory switches covered for use are also discussed in the review article Kis et al., JR Soc Interface. 12: 20141000 (2015) and summarized in Table 1 of Kis. In some embodiments, a regulatory switch for use in an access code system can be selected from any or a combination of the switches in Table 11. D. Nucleic acid based regulatory switches to control transgene expression
[00221] [00221] In some modalities, the regulatory switch to control the transgene expressed by ceDNA is based on a control mechanism based on nucleic acid. Exemplary nucleic acid control mechanisms are known in the art and are intended for use. For example, these mechanisms include riboswitches, such as those described in the documents, for example, US2009 / 0305253, US2008 / 0269258, US2017 / 0204477, WO2018026762A1, US patent 9,222,093 and EP application EP288071, and also described in the review by Villa JK et al. Microbiol Spectr. May 2018; 6 (3). Also included are transcriptional biosensors responsive to the metabolite, such as those described in the documents
[00222] [00222] In some embodiments, the regulatory switch is a tissue-specific self-inactivating regulatory switch, for example, as described in document US2002 / 0022018, in which the regulatory switch deliberately disables the expression of transgene in a site where the expression of transgene can be disadvantageous. In some embodiments, the regulatory switch is a system of gene expression reversible by recombinase, for example, as described in documents US2014 / 0127162 and US Patent.
[00223] [00223] In some modalities, the regulatory switch to control the transgene or gene of interest expressed by the ceDNA vector is a hybrid of a control mechanism based on nucleic acid and a regulatory system of small molecules. Such systems are well known to those skilled in the art and are intended for use herein. Examples of such regulatory switches include, but are not limited to, an LTRi or "Lac-Tet-RNAi" system, for example, as described in US2010 / 0175141 and in Deans T. et al., Cell., 2007, 130 ( two); 363-372, WO2008 / 051854 and US patent
[00224] [00224] In some embodiments, the regulatory switch to control the transgene or gene of interest expressed by the ceDNA vector involves circular permutation, as described in the US patent
[00225] [00225] In some modalities, a regulatory switch based on
[00226] [00226] In some embodiments, the regulatory switch to control the transgene or gene of interest expressed by the ceDNA vector is a post-transcriptional modification system. For example, that regulatory switch may be an aptazyme ribocomputer that is sensitive to tetracycline or theophylline, as described in US2018 / 0119156, GB201107768, WO2001 / 064956A3, patent EP 2707487 and Beilstein et al., ACS Synth. Biol., 2015, 4 (5), pp 526-534; Zhong et al., Elife. 2016 November 2; 5. pii: e18858. In some embodiments, it is envisaged that a person skilled in the art can encode the transgene and an inhibitory siRNA that contains a ligand-sensitive aptamer (OFF switch), the net result being a ligand-sensitive LIGA switch.
[00227] [00227] In some embodiments, the regulatory switch to control the transgene or gene of interest expressed by the ceDNA vector is a post-translational modification system. In alternative modalities, the gene of interest or protein is expressed as a pro-protein or pre-pro-protein, or has a signal response element (SRE) or a destabilizing domain (DD) attached to the expressed protein, avoiding thus ensuring the correct folding of proteins and / or activity until the post-translation modification has occurred. In the case of a destabilizing domain (DD) or SRE, the destabilizing domain is cleaved post-translationally in the presence of an exogenous agent or small molecule. One skilled in the art can use the control methods described in US patent 8,173,792 and PCT application WO2017180587. Other post-transcriptional control switches designed for use in the ceDNA vector to control functional transgenic activity are described in Rakhit et al., Chem Biol. 2014; 21 (9): 1238-52 and Navarro et al., ACS Chem Biol. 2016; 19; 11 (8): 2101-2104A.
[00228] [00228] In some embodiments, a regulatory switch to control the transgene or gene of interest expressed by the cDNA vector is a post-translational modification system that incorporates ligand-sensitive integers in the transgene coding sequence, so that the transgene or expressed protein are inhibited prior to splicing. For example, this has been demonstrated using 4-hydroxy tamoxifen and thyroid hormone (see, for example, patents in US 7,541,450, 9,200,045; 7,192,739, Buskirk et al., Proc Natl Acad Sci USA. 20 Jul 2004, 101 (29): 10505–10510; ACS Synth Biol. Dec 16, 2016; 5 (12): 1475-1484; and February 2005; 14 (2): 523-
[00229] [00229] Any known regulatory switch can be used in the ceDNA vector to control gene expression of the transgene expressed by the ceDNA vector, including those triggered by environmental changes. Additional examples include, without limitation; the BOC method by Suzuki et al., Scientific Reports 8; 10051 (2018); expansion of the genetic code and a non-physiological amino acid; radiation or ultrasound controlled on / off switches (see, for example, Scott S et al., Gene Ther. 2000 Jul; 7 (13): 1121-5; US patent 5,612,318; 5,571. 797; 5,770,581; 5,817,636; and WO1999 / 025385A1 In some embodiments, the regulating switch is controlled by an implantable system, for example, as described in US patent 7,840,263; US2007 / 0190028A1 in which it is expressed. - healthy gene is controlled by one or more forms of energy, including electromagnetic energy, which activates promoters operatively linked to the transgene in the ceDNA vector.
[00230] [00230] In some embodiments, a regulatory switch designed for use in the ceDNA vector is a hypoxia-mediated or stress-activated switch, for example, as described in document WO1999060142A2, patent in US 5,834,306; 6,218,179; 6,709,858; US2015 / 0322410; Greco et al., (2004) Targeted Cancer Therapies 9, S368, as well as FROG, TOAD and NRSE elements and conditionally inducible elements of silence, including hypoxia response elements (HREs), inflammatory response elements (IREs) and elements shear stress activated compounds (SSAEs), for example, as described in US Patent 9,394,526. Such a modality is useful to activate the expression of the transgene from the ceDNA vector after ischemia or in ischemic tissues and / or tumors.
[00231] [00231] In some embodiments, a regulatory switch designed for use in the ceDNA vector is an optogenetic regulatory switch (for example, controlled by light), for example, as one of the co-mutators reviewed in Polesskaya et al. , BMC Neurosci. 2018; 19 (Suppl 1): 12, and are also intended for use in this document. In such modalities, a ceDNA vector can comprise light-sensitive genetic elements and can regulate the expression of the transgene in response to visible wavelengths (for example, blue, close to IR). The ceDNA vectors that comprise optogenetic regulatory switches are useful when expressing the transgene in places on the body that can receive these light sources, for example, skin, eye, muscle etc., and can also be used when seeing ceDNA factors express transgenes in internal organs and tissues, in which the light signal can be provided by an appropriate means (for example, implantable device, as described in this document). Such optogenetic regulatory switches include the use of light-responsive elements or light-inducible transcriptional effector
[00232] [00232] Other embodiments of the invention relate to a ceDNA vector comprising an extermination switch. An extermination switch, as described herein, allows a cell comprising the ceDNA vector to be killed or to suffer programmed cell death as a means to permanently remove a introduced ceDNA vector from the individual's system. It will be understood by a person skilled in the art that the use of extermination switches in the ceDNA vectors of the invention would typically be coupled to targeting the ceDNA vector to a limited number of cells that the individual may acceptably lose or to a cell type in which apoptosis is desirable (for example, cancer cells). In all respects, an "extermination switch", as described in this document, is designed to provide rapid and robust cell death of the cell comprising the ceDNA vector in the absence of an input survival signal or other condition. specified information. In other words, an extermination switch encoded by a ceDNA vector here can restrict the cell survival of a cell that comprises a ceDNA vector to an environment defined by specific input signals. Such extermination switches serve as a function of biological biocontainment if it is desirable to remove an individual's ceDNA vector or ensure that it does not express the encoded transgene. Therefore, the
[00233] [00233] In some embodiments, a ceDNA vector may comprise an extermination switch that is a modular biological containment circuit. In some embodiments, a termination switch covered for use in the ceDNA vector is described in WO2017 / 059245, which describes a switch referred to as a "Deadman termination switch" that comprises a mutually inhibitory arrangement of at least two repressible sequences, so that an environmental signal represses the activity of a second molecule in the construction (for example, a small molecule-binding transcription factor is used to produce a 'surviving' state due to the repression of production of toxins). In cells that comprise a ceDNA vector that comprises a dead extermination switch, after the loss of the environmental signal, the circuit permanently changes to the 'death' state, where the toxin is now depressurized, resulting in the production of toxins that kill the cell. In another embodiment, a synthetic biological circuit referred to as an "access code circuit" or "access code extermination switch" is provided that uses hybrid transcription factors (TFs) to build complex environmental requirements for survival of the cells. The deadman and Passcode kill switches described in WO2017 / 059245 are particularly useful for use in ceDNA vectors, as they are modular and customizable, both in terms of the environmental conditions that control the activation of the circuit and in the output modules that control the cell destination. With the proper choice of toxins, including, without limitation, an endo-nuclease, for example, an EcoRI, the access code access code circuits present in the ceDNA vector can be used not only to kill the host cell it comprises the ceDNA vector, but also to degrade its genome and accompanying plasmids.
[00234] [00234] Other extermination switches known to a person skilled in the art are covered for use in the ceDNA vector as described in this document, for example, as described in documents US2010 / 0175141; US2013 / 0009799; US2011 / 0172826; US2013 / 0109568, as well as extermination switches described in Jusiak et al., Reviews in Cell Biology and Molecular Medicine; 2014; 1- 56; Kobayashi et al., PNAS, 2004; 101; 8419-9; Marchisio et al., Int. Journal of Biochem and Cell Biol., 2011; 43; 310-319; and in Reinshagen et al., Science Translational Medicine, 2018, 11.
[00235] [00235] Therefore, in some embodiments, the cDNA vector may comprise an extermination switch nucleic acid construct, which comprises the nucleic acid encoding an effector toxin or reporter protein, in which the expression of the toxin effector (eg, a deadly protein) or reporter the protein is controlled by a predetermined condition. For example, a predetermined condition may be the presence of an environmental agent, such as, for example, an exogenous agent, without which the cell will become standard for the expression of the effector toxin (for example, a death protein) and will be killed. In alternative modalities, a predetermined condition is the presence of two or more environmental agents, for example, the cell will survive only when two or more necessary exogenous agents are provided, and without any of which, the cell comprising the ceDNA vector is killed .
[00236] [00236] In some embodiments, the ceDNA vector is modified to incorporate an extermination switch to destroy cells that comprise the ceDNA vector to effectively end the in vivo expression of the transgene being expressed by the ceDNA vector (for example, therapeutic gene, protein or peptide, etc.). Specifically, the ceDNA vector is genetically modified to express an exchange protein that is not functional in mammalian cells under normal physiological conditions. Only after the administration of a drug or environmental condition that specifically targets that exchange protein, cells that express the exchange protein will be destroyed, thus ending the expression of the therapeutic protein or peptide. For example, it has been reported that cells that express HSV-thymidine kinase can be killed after the administration of drugs, such as ganciclovir and cytosine deaminase. See, for example, Dey and Evans, Suicide Gene Therapy, by Herpes Simplex Virus-1 Timidine Kinase (HSV-TK), in Targets in Gene Therapy, edited by You (2011); and Beltinger et al., Proc. Natl. Acad. Sci. USA 96 (15): 8699-8704 (1999). In some embodiments, the ceDNA vector may comprise a siRNA extermination switch referred to as DISE (Survival Gene Eliminated Death) (Murmann et al., Oncotarget. 2017; 8: 84643-84658. DISE induction in cells carcinogens of the ovary in vivo).
[00237] [00237] In some aspects, a deadman extermination switch is a biological circuit or system that makes a cellular response sensitive to a predetermined condition, such as the lack of an agent in the cell growth environment, for example, an exogenous agent. Such a circuit or system may comprise a nucleic acid construct that comprises expression modules that form a deadman regulatory circuit sensitive to the predetermined condition, the construction that comprises expression modules that form a regulatory circuit.
[00238] [00238] In some embodiments, the effector is a toxin or a protein that induces a cell death program. Any protein that is toxic to the host cell can be used. In some embodiments, the toxin kills only the cells in which it is expressed. In other modalities, the toxin kills other cells in the same host organism. Any of a large number of products that will lead to cell death can be employed in a deadman extermination switch. Particularly useful are agents that inhibit DNA replication, protein translation or other processes or, for example, that degrade the host cell's nucleic acid. To identify an efficient mechanism to kill host cells after activating the circuit, several toxin genes that directly damage the host cell's DNA or RNA have been tested. The EcoRI 21 endonuclease, the ccdB 22 inhibitory DNA gyrase and the mazF toxin ribonuclease type 23 were tested due to the fact that they are well characterized, are native to E. coli, and provide a variety of killing mechanisms. To increase the robustness of the circuit and provide an independent method of cell-dependent cell death, the system can be further adapted to express, for example, a targeted protease or nuclease that further interferes with the repressor that holds the gene for death in the "off" state. With the loss or withdrawal of the survival sign
[00239] [00239] As used herein, the term "predetermined entry" refers to an agent or condition that influences the activity of a transcription factor polypeptide in a known manner. Generally, these agents can bind and / or change the conformation of the transcription factor polypeptide to thereby modify the activity of the transcription factor polypeptide. Examples of predetermined inputs include, without limitation, environmental input agents that are not necessary for the survival of a given host organism (ie, in the absence of a synthetic biological circuit, as described in this document). Conditions that can provide a predetermined input include, for example, temperature, for example, in which the activity of one or more factors is sensitive to temperature, the presence or absence of light, including the light of a certain spectrum wavelengths, and the concentration of a gas, salt, metal or mineral. Environmental entry agents include, for example, a small molecule, biological agents such as pheromones, hormones, growth factors, metabolites, nutrients and the like and their analogues; concentrations of chemicals, environmental by-products, metal ions and other molecules or agents;
[00240] [00240] In some modalities, reporters are used to quantify the intensity or activity of the signal received by the programmable synthetic biological modules or circuits of the invention. In some embodiments, reporters can be fused in-frame with other protein coding sequences to identify where a protein is located in a cell or organism. Luciferases can be used as effector proteins for various modalities described here, for example, measuring low levels of gene expression, due to the fact that cells tend to have little or no background luminescence in the absence of a luciferase. In other modalities, enzymes that produce colored substrates can be quantified using spectrophotometers or other instruments that can perform absorbance measurements, including plate readers. Like luciferases, enzymes such as β-galactosidase can be used to measure low levels of gene expression due to the fact that they tend to amplify low signals. In some embodiments, an effector protein can be an enzyme that can degrade or destroy a given toxin. In some modalities, an effector protein can be an odorant enzyme that converts a substrate into an odorant product. In some modalities, an effector protein may be an enzyme that phosphorylates or dephosphorylates small molecules or other proteins, or an enzyme that methylates or demethylates other proteins or DNA.
[00241] [00241] In some embodiments, an effector protein may be a receptor, ligand or lytic protein. Receptors tend to have three domains: an extracellular domain for ligand binding, such as proteins, peptides or small molecules, a transmembrane domain and an intracellular or cytoplasmic domain that can often participate in some type of signal transduction event , such as phosphorylation. In some embodiments, carrier, channel, or pump gene sequences are used as effective proteins. Examples and non-limiting sequences of effector proteins for use with the extermination switches described in this document can be found in the Standard Biological Parts Register on the Internet at parts.igem.org.
[00242] [00242] As used herein, a "modulating protein" is a protein that modulates the expression of a target nucleic acid sequence. Modulating proteins include, for example, transcription factors, including transcription activators and repressors, among others, and proteins that bind to or modify a transcription factor and influence its activity. In some embodiments, a modulating protein includes, for example, a protease that degrades a protein factor involved in regulating the expression of a target nucleic acid sequence. Preferred modulating proteins include modular proteins in which, for example, elements or domains of DNA binding and binding to the input or responsive agents are separable and transferable, so that, for example, the DNA binding domain of a first modulating protein with the domain responsive to the second entry agent results in a new protein that binds the DNA sequence recognized by the first protein, but is sensitive to the entry agent to which the second protein normally responds. Therefore, as used herein, the term "modulator polypeptide" and the more specific "repressor polypeptide" include, in addition to the specified polypeptides, for example, "a LacI (repressor) polypeptide", variants or derivatives thereof. polypeptides that respond to a different input agent or variant. Thus, for a LacI polypeptide, LacI mutants or variants are included that bind to agents other than lactose or IPTG. A wide range of such agents is known in the art.
[00243] [00243] Table 11. Exemplary regulating switches. b switching ON by an effector; other than removing the effector that gives the OFF state. cChanging OFF by an e- fector; different from removing the effector that gives the ON state. dA ligand or other physical stimulus (for example, temperature, electromagnetic radiation, electricity) that stabilizes the switch in the ON and OFF state. refers to the reference number quoted in Kis et al., JR Soc Interface. 12: 20141000 (2015), in which the article and the references cited in it are incorporated here for reference. Commutator Commutator referred to in name origin effig Ligab OFF AC ciase Transcriptional Switches Arabidopsis thaliana, 1 ABA yes no absisic acid [19] yeast 2 AIR yes no Aspergillus nidulans Acetaldehyde [20] Chlamydia pneumoni- 3 ART yes no l-arginine [21] aee BEARON, BEA- 4 yes yes Campylobacter jejuni Bile acid [22]
[00244] [00244] As described in this document, the ceDNA vector can be obtained by the process that comprises the steps of: a) instilling a population of host cells (for example, insect cells) that house the expression construct model polynucleotide (for example, a plasmid of ceDNA, a ceDNA-Bacmide and / or a ceDNA-baculovirus), which is devoid of sequences encoding the viral capsid, in the presence of a Rep protein under effective conditions and for a enough time to induce the production of the ceDNA vector in host cells, and in which the host cells do not comprise coding sequences for the viral capsid; and b) harvest and isolate the ceDNA vector from host cells.
[00245] [00245] The presence of the isolated ceDNA vector from the host cells can be confirmed by digesting the isolated DNA from the host cell with a restriction enzyme with a single recognition site in the ceDNA vector and analyzing the DNA material digested in a non-denaturing gel confirm the presence of characteristic bands of linear and continuous DNA compared to linear and non-continuous DNA.
[00246] [00246] In yet another aspect, the invention provides the use of host cell lines that stably integrated the polynucleotide expression model of the DNA vector (ceDNA model) into its own genome in the production of the non-viral DNA vector, for example, as described in Lee L. et al. (2013) Plos One 8 (8): e69879. Preferably, Rep is added to the host cells in an MOI of about 3. When the host cell line is a mammalian cell line, for example, HEK293 cells, the cell lines may have a polynucleotide vector model. stably integrated and a second vector, like the herpes virus can be used to introduce the Rep protein into cells, allowing the excision and amplification of ceDNA in the presence of Rep and the helper virus.
[00247] [00247] In one embodiment, the host cells used to produce the ceDNA vectors described here are insect cells, and the baculovirus is used to deliver the polynucleotide encoding the Rep protein and the polynucleotide expression construct model of non-viral DNA vector for ceDNA, for example, as described in
[00248] [00248] The ceDNA vector is then harvested and isolated from host cells. The time to harvest and collect ceDNA vectors described here from cells can be selected and optimized to achieve high yield production of ceDNA vectors. For example, harvest time can be selected in view of cell viability, cell morphology, cell growth, etc. In a modality, cells are grown in sufficient conditions and harvested long enough after baculoviral infection to produce ceDNA vectors, but before in most cases cells begin to die because of baculoviral toxicity. DNA vectors can be isolated using plasmid purification kits, such as Qiagen Endo-Free Plasmid plasmid kits. Other methods developed for plasmid isolation can also be adapted for DNA vectors. Generally, any method of nucleic acid purification can be adopted.
[00249] [00249] DNA vectors can be purified by any means known to those skilled in the art for DNA purification. In one embodiment, the ceDNA vectors are purified like DNA molecules. In another modality, ceDNA vectors are purified as exosomes or microparticles.
[00250] [00250] The presence of the ceDNA vector can be confirmed by digesting the isolated vector DNA from the cells with a restriction enzyme with a single recognition site in the DNA vector and analyzing the digested and undigested DNA material using electrophoresis in gel to confirm the presence of characteristic bands of linear and continuous DNA compared to linear and non-continuous DNA. Figures 4C and 4E illustrate a modality to identify the presence of closed-ended ceDNA vectors produced by
[00251] [00251] A ceDNA plasmid is a plasmid used for the further production of a ceDNA vector. In some embodiments, a ceDNA plasmid can be constructed using known techniques to provide at least the following as components operably linked in the direction of transcription: (1) a 5 'ITR sequence; (2) an expression cassette containing a cis regulatory element, for example, a promoter, inducible promoter, regulatory switch, enhancers and the like; and (3) a 3 'ITR sequence, wherein the 3' ITR sequence is asymmetric with respect to the 5 'ITR sequence. In some embodiments, the expression cassette flanked by ITRs comprises a cloning site for the introduction of an exogenous sequence. The expression cassette replaces the rep and cap coding regions of the AAV genomes.
[00252] [00252] In one aspect, a ceDNA vector is obtained from a plasmid, here referred to as a "ceDNA plasmid", encoding in this order: a first inverted terminal repeat (ITR) of the adenoassociated virus (AAV), a cassette of expression comprising a mutated or modified AAV transgene and an AAV ITR, wherein said ceDNA plasmid is devoid of coding sequences for the AAV capsid protein. In alternative embodiments, the ceDNA plasmid encodes in this order: a first modified or mutated AAV ITR, an expression cassette comprising a transgene and a second (or 3 ') wild-type AAV ITR, wherein said ceDNA O plasmid is devoid of AAV capsid protein coding sequences and in which the 5 'and 3' ITRs are asymmetric to each other. In alternative embodiments, the ceDNA plasmid encodes in this order: a first modified or mutated AAV ITR, an expression cassette comprising a transgene and a second (or 3 ') mutated or modified AAV ITR, wherein said ceDNA O plasmid is devoid of coding sequences for AAV capsid protein and in which the 5 'and 3' modified ITRs are different and do not have the same modifications.
[00253] [00253] In an additional embodiment, the plasmid system of ceDNA is devoid of coding sequences of the viral capsid protein (that is, devoid of AAV capsid genes, but also of capsid genes from other viruses) . In addition, in a specific modality, the plasmid of ceDNA is also devoid of AAV Rep protein coding sequences. Therefore, in a preferred embodiment, the ceDNA plasmid is devoid of the functional genes of AAV cap and rep of AAV GG-3 'to AAV2) plus a variable palindromic sequence that allows hairpin formation.
[00254] [00254] A ceDNA plasmid of the present invention can be generated using natural nucleotide sequences from the genomes of any AAV serotypes well known in the art. In one embodiment, the main structure of the cDNA plasmid is derived from the genomes AAV1, AAV2, AAV3, AAV4, AAV5, AAV 5, AAV7, AAV8, AAV9, AAV10, AAV 11, AAV12, AAVrh8, AAVrh10, AAV -DJ and AAV- DJ8. For example, NCBI: NC 002077; NC 001401; NC001729; NC001829; NC006152; NC 006260; NC 006261; Kotin and Smith, The Springer Index of Virus, available at the URL maintained by Springer (at the web address: oesys.springer.de/viruses/database/mkchapter.asp virID=42.04.)(note -references to a URL or database data refers to the contents of the URL or database as of the effective date of filing this order). In a specific modality, the main structure of the plasma
[00255] [00255] A ceDNA plasmid can optionally include a selectable or selection marker for use in establishing a ceDNA vector producing cell line. In one embodiment, the selection marker can be inserted downstream (i.e., 3 ') from the 3' ITR sequence. In another embodiment, the selection marker can be inserted upstream (i.e., 5 ') of the 5' ITR sequence. Appropriate selection markers include, for example, those that provide resistance to the drug. Selection markers can be, for example, a gene for resistance to blasticidin S, kanamycin, genetics and the like. In a preferred embodiment, the drug selection marker is a blasticidin S resistance gene.
[00256] [00256] An exemplary ceDNA (for example, rAAV0) is produced from an rAAV plasmid. A method for producing an rAAV vector may comprise: (a) providing a host cell with an rAAV plasmid as described above, in which both the host cell and the plasmid are devoid of genes encoding the capsid protein, ( b) cultivate the cell host under conditions that allow the production of a ceDNA genome, and (c) harvest the cells and isolate the AAV genome produced from said cells. C. Exemplifying method of producing ceDNA vectors from ceDNA plasmids
[00257] [00257] Methods for producing ceDNA vectors without capsid are also provided here, notably a method with a high enough yield to provide enough vector for in vivo experiments.
[00258] [00258] In some embodiments, a method for producing a ceDNA vector comprises the steps of: (1) introducing the nucleic acid construct comprising an expression cassette and two asymmetric ITR sequences into a host cell ( for example, Sf9 cells), (2) optionally establishing a clonal cell line, for example, using a selection marker on the plasmid, (3) introducing a Rep coding gene (by transfection or infection with a baculovirus carrying said gene) in said insect cell, and (4) harvesting the cell and purifying the ceDNA vector. The nucleic acid construct comprising an expression cassette and two ITR sequences described above for the production of the AAV vector without capsid can be in the form of a cfAAV plasmid, or Bacid or Baculovirus generated with the cfAAV plasmid as described below. The nucleic acid construct can be introduced into a host cell by transfection, viral transduction, stable integration or other methods known in the art. D. Cell lines:
[00259] [00259] Host cell lines used in the production of a ceDNA vector may include insect cell lines derived from Spodoptera frugiperda, such as Sf9 Sf21, or Trichoplusia ni cell, or other invertebrate cell lines, vertebrates or other cell lines eukaryotic, including mammalian cells. Other cell lines known to a person skilled in the art can also be used, such as HEK293, Huh-7, HeLa, HepG2, HeplA, 911, CHO, COS, MeWo, NIH3T3, A549, HT1 180, monocytes and mature and immature dendritic cells. Host cell lines can be transfected for stable expression of the plasmid ceDBA for production of high-yielding ceDNA vector.
[00260] Plasmid cDNAs can be introduced into Sf9 cells by transfection transients using reagents (eg,
[00261] [00261] Examples of the process for obtaining and isolating ceD-NA vectors are described in Figures 4A-4E and the specific examples below. The ceDNA vectors described here can be obtained from a producer cell that expresses the AAV Rep protein (or proteins), later transformed with a plasmid of ceDNA, ce-DNA-bacmid or ceDNA-baculovirus. Plasmids useful for the production of ceDNA vectors include plasmids shown in Figure 8A (useful for the production of Rep BIICs) in Figure 8B (plasmid used to obtain a ceDNA vector).
[00262] [00262] In one aspect, a polynucleotide encodes the Rep protein of AAV (Rep 78 or 68) delivered to a producing cell in a plasmid (Rep-plasmid), a bacmid (Rep-bacmid) or a baculo-virus ( Rep-baculovirus). Rep-plasmid, Rep-bacmid and Rep-baculovirus can be generated by the methods described above.
[00263] [00263] Methods for producing a ceDNA vector, which is an exemplary ceDNA vector, are described in this document. The expression constructs used to generate the ceDNA vectors of the present invention can be a plasmid (eg, ceDNA plasmids), a Bacmide (eg, ceDNA-bacmid) and / or a bacterovirus (eg, ceDNA -baculovirus). Just as an example, a ceDNA vector can be generated from cells co-infected with ceDNA-baculovirus and Rep-baculovirus. Rep proteins produced from Rep-baculovirus can replicate ceDNA-baculovirus to generate ceDNA vectors. Alternatively, ceDNA vectors can be generated from cells transfected stably with a construct that comprises a sequence encoding the AAV Rep protein (Rep78 / 52) delivered in Rep plasmids, Rep bacmids or Rep baculoviruses . The ceDNA-Baculovirus can be transiently transfected into the cells, replicated by the Rep protein and produced ceDNA vectors.
[00264] [00264] The bacmid (for example, ceDNA-bacmid) can be transfected into permissive insect cells, such as the Sf9, Sf21, Tni (Trichoplusia ni) cell, High Five cell, and generate ceDNA-baculovirus, which is a recombinant baculovirus , including the strings comprising asymmetric ITRs and the expression cassette. The ceDNA-baculovirus can be re-infected in insect cells to obtain a next generation of recombinant baculovirus. Optionally, the step can be repeated one or more times to produce the recombinant baculovirus in greater quantity.
[00265] [00265] The time to harvest and collect ceDNA vectors described here from cells can be selected and optimized to achieve high yield production of ceDNA vectors. For example, harvest time can be selected in view of cell viability, cell morphology, cell growth, etc. Normally, cells can be harvested long enough after baculoviral infection to produce ceDNA vectors (eg, ceDNA vectors), but before most cells start to die because of viral toxicity. The ceDNA vectors can be isolated from Sf9 cells using plasmid purification kits, such as the Qiagen ENDO-FREE PLASMID® kits. Other methods developed for plasmid isolation can also be adapted for ceDNA vectors. Generally, any nucleic acid purification method known in the art can be adopted, as well as commercially available DNA extraction kits.
[00266] [00266] Alternatively, the purification can be implemented by submitting a cell pellet to an alkaline lysis process, centrifuging the resulting lysate and performing the chromatographic separation. As a non-limiting example, the process can be carried out by loading the supernatant onto an ion exchange column (eg, SARTOBIND Q®) which retains nucleic acids and eluting (eg, with a 1.2 M NaCl solution) and performing additional chromatographic purification on a gel filtration column (for example, 6 fast flow GE). The AAV vector without capsid is then recovered by, for example, precipitation.
[00267] [00267] In some embodiments, ceDNA vectors can also be purified in the form of exosomes or microparticles. It is known in the art that many cell types release not only soluble proteins, but also complex loads of proteins / nucleic acids via detachment from membrane microvesicles (Cucci et al, 2009; EP 10306226.1). These vesicles include microvesicles (also known as microparticles) and exosomes (also called nanovesicles), which comprise proteins and RNA as a charge. Microvesicles are generated from the direct sprouting of the plasma membrane, and the exosomes are released into the extracellular environment by fusing the multivesicular endosomes with the plasma membrane. Thus, microvesicles and / or
[00268] [00268] Microvesicles can be isolated by subjecting the culture medium to filtration or ultracentrifugation at 20,000 xg and exosomes at
[00269] [00269] Another aspect of the invention listed here relates to methods for purifying ceDNA vectors from host cell lines that have stably integrated a ceDNA construct into their own genome. In one embodiment, the ceDNA vectors are purified as DNA molecules. In another embodiment, the ceDNA vectors are purified as exosomes or microparticles.
[00270] [00270] Figure 5 shows a gel confirming the production of ceD-NA from multiple plasmid constructs of ceDNA using the method described in the Examples. The ceDNA is confirmed by a characteristic band pattern on the gel, as discussed in relation to Figure 4D in the examples. Other characteristics of the cDNA production process and intermediates are summarized in Figures 6A and 6B, and Figures 7A and 7B, as described in the Examples. VII. Pharmaceutical compositions
[00271] [00271] In another aspect, pharmaceutical compositions are provided. The pharmaceutical composition comprises a cDNA vector as described herein and a pharmaceutically acceptable carrier or diluent.
[00272] [00272] The DNA vectors described herein can be incorporated into pharmaceutical compositions suitable for administration to an individual for in vivo delivery to the individual's cells, tissues or organs. Typically, the pharmaceutical composition comprises a ceDNA vector as described herein and a pharmaceutically acceptable carrier. For example, the ceDNA vectors described herein can be incorporated into a pharmaceutical composition suitable for a desired route of therapeutic administration (for example, parenteral administration). Passive tissue transduction by high pressure intravenous or intra-arterial infusion, as well as intracellular injection, such as intranuclear microinjection or intracytoplasmic injection, are also contemplated. Pharmaceutical compositions for therapeutic purposes can be formulated as a solution, microemulsion, dispersion, liposomes or other ordered structure suitable for high concentration of ceDNA vector. Sterile injectable solutions can be prepared by incorporating the ceDNA vector compound in the required amount in an appropriate buffer with one or a combination of ingredients listed above, as needed, followed by filtered sterilization.
[00273] [00273] Pharmaceutically active compositions comprising a ceDNA vector can be formulated to deliver a transgenic nucleic acid to the cells of a receptor, resulting in the therapeutic expression of the transgene therein. The composition can also include a pharmaceutically acceptable carrier.
[00274] [00274] A ceDNA vector as described in this document can be incorporated into a pharmaceutical composition suitable for topical, systemic, intra-amniotic, intrathecal, intracranial, intra-arterial, intravenous, intralymphatic, intraperitoneal, subcutaneous, tracheal, intracted (eg, intramuscular, intracardiac, intrahepatic, intrarenal, intracerebral), intrathecal, intravesical, conjunctival (eg, extraorbital, intraorbital, retro orbital, intraretinal, subretinal, choroidal, sub-choroidal, intrastromal, intracameral and intravitreal), intracochlear and oral (mucosa) rectal, nasal administration). Passive tissue transduction by high pressure intravenous or intra-arterial infusion, as well as intracellular injection, such as intravuclear microinjection or intracytoplasmic injection, are also contemplated.
[00275] [00275] Pharmaceutical compositions for therapeutic purposes generally must be sterile and stable under the conditions of manufacture and storage. The composition can be formulated as a solution, microemulsion, dispersion, liposomes or other ordered structure suitable for high concentration of ceDNA vector. Sterile injectable solutions can be prepared by incorporating the ceDNA vector compound in the required amount in an appropriate buffer with one or a combination of ingredients listed above, as needed, followed by filtered sterilization.
[00276] [00276] Various techniques and methods are known in the art for delivering nucleic acids to cells. For example, nucleic acids,
[00277] [00277] Another method for delivering nucleic acids, such as ceDNA to a cell, is by conjugating the nucleic acid with a ligand that is internalized by the cell. For example, the ligand can bind to a receptor on the cell surface and internalized via endocytosis. The ligand can be covalently attached to a nucleotide in the nucleic acid. Exemplary conjugates for the delivery of nucleic acids in a cell are described, for example, in WO2015 / 006740, WO2014 / 025805, WO2012 / 037254, WO2009 / 082606, WO2009 / 073809, WO2009 / 018332, WO2006 / 112872, WO2004 / 090108 , WO2004 / 091515 and WO2017 / 177326.
[00278] [00278] Nucleic acids, such as ceDNA, can also be delivered to a cell by transfection. Useful methods of transfection include, without limitation, lipid-mediated transfection, polymer-mediated cationic transfection, or calcium phosphate precipitation. Transfection reagents are well known in the art and include, without limitation, TurboFect Transfection Reagent (Thermo Fisher Scientific), Pro-Ject Reagent (Thermo Fisher Scientific), TRANSPASS ™ P Protein Transfection Reagent (New England Biolabs) , CHARIOT ™ reagent for protein delivery (active reason), PROTEOJUICE ™ protein transfection reagent (EMD Millipore), 293fectin, LIPOFECTAMINE ™ 2000, LIPOFECTA-
[00279] [00279] Non-viral delivery methods for nucleic acids in vivo or ex vivo include electroporation, lipofection (see US Patent
[00280] [00280] The ceDNA vectors as described herein can also be administered directly to an organism for cell transduction in vivo. Administration is carried out by any of the routes normally used to introduce a molecule into final contact with blood or tissue cells, including, among others, injection, infusion, topical application and electroporation. Suitable methods for administering these nucleic acids are available and are well known to those skilled in the art, and although more than one route can be used to administer a specific composition, a specific route can often provide a more immediate reaction and more effective than another route.
[00281] [00281] Methods for introducing a nucleic acid vector cDNA vector, as described herein, can be delivered to hematopoietic stem cells, for example, by the methods described, for example, in US Patent 5,928. 638.
[00282] [00282] The ceDNA vectors according to the present invention can be added to liposomes for delivery to a target cell or organ in an individual. Liposomes are vesicles that have at least one lipid bilayer. Liposomes are typically used as carriers for delivery of drugs / therapies in the context of pharmaceutical development. They work by fusing with a cell membrane and repositioning its lipid structure to provide a drug or active pharmaceutical ingredient (API). The liposome compositions for this distribution are composed of phospholipids, especially compounds with a phosphatidylcholine group, however, these compositions can also include other lipids.
[00283] [00283] In some respects, the description provides a liposome formulation that includes one or more compounds with a functional group
[00284] [00284] In some respects, the description provides a liposome formulation that will provide an API with a prolonged or controlled release profile over a period of hours to weeks. In some related aspects, the liposome formulation may comprise aqueous chambers that are linked by lipid bilayers. In other related aspects, the liposome formulation encapsulates an API with components that undergo a physical transition at elevated temperature that releases the API over a period of hours to weeks.
[00285] [00285] In some respects, the liposome formulation comprises sphingomyelin and one or more lipids described here. In some respects, the liposome formulation comprises optisomes.
[00286] [00286] In some respects, the description provides a liposome formulation that includes one or more lipids selected from: N- (carbonyl-methoxypolyethylene glycol 2000) -1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, (lipid conjugated to distearoyl-sn-glycerophosphoethanolamine), MPEG (methoxy polyethylene glycol), HSPC (HSPC (hydrogenated soy phosphatidylcholine); PEG (polyethylene glycol); DSPE (distearoyl-sn-glycerophosphoethanolamine); DSPC (distearoylphosphine); (dioleoylphosphatidylcholine); DPPG (dipalmitoylphosphatidyl glycerol); EPC (egg phosphatidylcholine); DOPS (dioleoylphosphatidylcholine); POPC (palmitoyloleylphosphatidylcholine); SM (sphingomyethyl) dim-
[00287] [00287] In some respects, the description provides a liposome formulation comprising phospholipid, cholesterol and a PE-Guided lipid in a molar ratio of 56: 38: 5. In some respects, the overall lipid content of the liposomal formulation is 2 to 16 mg / mL. In some respects, the description provides a liposome formulation comprising a lipid containing a phosphatidylcholine functional group, a lipid containing an ethanolamine functional group and a PEGylated lipid. In some respects, the description provides a liposome formulation comprising a lipid containing a phosphatidylcholine functional group, a lipid containing an ethanolamine functional group and a PEGylated lipid in a molar ratio of 3: 0.015: 2, respectively. In some respects, the description provides a liposome formulation comprising a lipid containing a phosphatidylcholine functional group, cholesterol and a PEGylated lipid. In some aspects, the description provides a liposome formulation that comprises a lipid containing a phosphatidylcholine and cholesterol functional group. In some respects, the PEGylated lipid is PEG-2000-DSPE. In some respects, the description provides a liposome formulation that comprises DPPG, soybean PC, lipid conjugate MPEG-DSPE and cholesterol.
[00288] [00288] In some respects, the description provides a liposome formulation comprising one or more lipids containing a phosphatidylcholine functional group and one or more lipids containing an ethanolamine functional group. In some respects, the description provides a liposome formulation comprising one or more: lipids containing a phosphatidylcholine functional group, lipids containing an ethanolamine functional group and sterols, for example, cholesterol. In some respects, the liposome formulation comprises DOPC / DEPC; and DOPE.
[00289] [00289] In some respects, the description provides a liposome formulation which further comprises one or more pharmaceutical excipients, for example, sucrose and / or glycine.
[00290] [00290] In some respects, the description provides a liposome formulation that is wilted in the unilamellar or multilamellar structure. In some respects, the description provides a liposome formulation comprising multivesicular particles and / or foam-based particles. In some respects, the description provides a formulation of liposomes that are larger in size relative to common nanoparticles and about 150 to 250 nm in size. In some ways, the liposome formulation is a lyophilized powder.
[00291] [00291] In some respects, the description provides a liposome formulation that is made and loaded with ceDNA vectors described or described herein, adding a weak base to a mixture with the isolated ceDNA outside the liposome. This addition raises the pH outside the liposomes to approximately 7.3 and brings the API to the liposome. In some respects, the description provides a liposome formulation with an acidic pH inside the liposome. In such cases, the interior of the liposome can be at pH 4 to 6.9 and, more preferably, at pH 6.5. In other respects, the description provides a liposome formulation made using intraliposomal drug stabilization technology. In such cases, high-charge polymeric or non-polymeric anions and intraliposomal capture agents are used, for example, polyphosphate or saccharose octasulfate.
[00292] [00292] In other respects, the description provides a liposome formulation comprising phospholipids, lecithin, phosphatidylcholine and phosphatidylethanolamine.
[00293] [00293] Delivery reagents, such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles and the like, can be used to introduce the compositions of the present description into suitable host cells. In particular, nucleic acids can be formulated for delivery encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, a nanoparticle, a gold particle or the like. Such formulations may be preferred for the introduction of pharmaceutically acceptable formulations of the nucleic acids described herein.
[00294] [00294] Various delivery methods known in the art or modification thereof can be used to deliver ceDNA vectors in vitro or in vivo. For example, in some embodiments, ceDNA vectors are delivered by transiently penetrating the cell membrane by mechanical, electrical, ultrasound, hydrodynamic, or energy-based laser so that incoming DNA into the second cells is facilitated. For example, a ceDNA vector can be delivered by transiently disrupting the membrane cell by squeezing the cell through a channel size restriction or by other means known in the art. In some cases, a ceDNA vector alone is injected directly as naked DNA into the skin, thymus, heart muscle, skeletal muscle or liver cells.
[00295] [00295] In some cases, a ceDNA vector is delivered by gene gene. Spherical particles of gold or tungsten (1–3 μm in diameter) coated with AAV vectors without capsid can be accelerated at high speed by pressurized gas to penetrate the target cells of the tissue.
[00296] [00296] In some embodiments, electroporation is used to supply the ceDNA vectors. Electroporation causes temporary destabilization of the target cell tissue of the cell membrane by inserting a pair of electrodes into the tissue, so that DNA molecules in the surrounding environment of the destabilized membrane can penetrate the cytoplasm and the nucleoplasm of the cell. Electroporation has been used in vivo for many types of tissues, such as skin, lung and muscle.
[00297] [00297] In some cases, a ceDNA vector is delivered by hydrodynamic injection, which is a simple and highly efficient method for the direct intracellular delivery of any water-soluble compounds and particles in internal organs and skeletal muscle in a entire member.
[00298] [00298] In some cases, ceDNA vectors are delivered by ultrasound, producing nanoscopic pores in the membrane to facilitate the intracellular delivery of DNA particles to cells of internal organs or tumors, so that the size and concentration of the plasmid DNA play a big role in the efficiency of the system. In some cases, ceDNA vectors are delivered by magnetofection using magnetic fields to concentrate particles containing nucleic acid in the target cells.
[00299] [00299] In some cases, chemical delivery systems can be used, for example, using nanomeric complexes, which include compacting negatively charged nucleic acid by polycationic nanomeric particles, belonging to cationic liposomes / micelles or cationic polymers. The cationic lipids used for the delivery method include, but are not limited to, monovalent cationic lipids, polyvalent cationic lipids, guanidine-containing compounds, cholesterol-derived compounds, cationic polymers (eg poly (ethylenimine), poly-L-lysine, protamine, other cationic polymers) and lipid-polymer hybrid. A. Exosomes:
[00300] [00300] In some modalities, a vector of ceDNA as described
[00301] [00301] In some embodiments, a ceDNA vector as described in this document is delivered by a lipid nanoparticle. Generally, lipid nanoparticles comprise an ionizable lipid amine (e.g., 4- (dimethylamino) hepta-triaconta-6,9,28,31-tetraen-19-yl, DLin-MC3-DMA, a phosphatidylcholine ( 1,2-distearoil-sn-glycero-3-phosphocholine, DSPC), cholesterol and a lipid coating (polyethylene glycol-dimyristolglycerol, PEG-DMG), for example as described by Tam et al. (2013). Lipid Nano-particles for siRNA delivery.Pharmaceuticals 5 (3): 498-507.
[00302] [00302] In some embodiments, a lipid nanoparticle has an average diameter between about 10 and about 1,000 nm. In some embodiments, a lipid nanoparticle has a diameter of less than 300 nm. In some embodiments, a lipid nanoparticle has a diameter between about 10 and about 300 nm. In some modes, a lipid nanoparticle has a diameter of less than 200 nm. In some embodiments, a lipid nanoparticle has a diameter between about 25 and about 200 nm. In some embodiments, a preparation of lipid nanoparticles (for example, a composition comprising a plurality of lipid nanoparticles) has a size distribution in which the average size (for example, diameter) is about 70 nm at about 200 nm and, more typically, the average size is about 100 nm or less.
[00303] [00303] Various lipid nanoparticles known in the art can be used to provide the ceDNA vector described in this document. For example, several methods of administration using lipid nanoparticles are described in US patents
[00304] [00304] In some modalities, a ceDNA vector described here is delivered by a gold nanoparticle. Generally, a nucleic acid can be covalently linked to a gold nanoparticle or non-covalently linked to a gold nanoparticle (for example, linked by a charge-charge interaction), for example, as described by Ding et al. (2014). Gold Nanoparticles for Nucleic Acid Delivery. Mol. Ther. 22 (6); 1075-1083. In some embodiments, gold nucleic acid nanoparticle conjugates are produced using methods described, for example, in US Patent 6,812,334. C. Liposomes
[00305] [00305] The formation and use of liposomes is generally known to those skilled in the art. Liposomes have been developed with better serum stability and circulation for half a time (U.S. Patent No. 5,741,516). In addition, several methods of liposomal and liposome-like preparations have been described as potential drug carriers (US Patents 5,567,434; 5,552,157;
[00306] [00306] Liposomes have been used successfully with several types of cells that are normally resistant to transfection by other procedures. In addition, liposomes are free of DNA length restrictions, typical of virus-based delivery systems. Liposomes have been used effectively to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors and allosteric effectors into a variety of cell lines and cultured animals. In addition, several successful clinical trials examining the effectiveness of liposome-mediated drug delivery have been completed.
[00307] [00307] Liposomes are formed from phospholipids dispersed in aqueous medium and spontaneously form multilamellar concentric multilayered vesicles (also called multilamellar vesicles (MLVs). MLVs generally have diameters from 25 nm to 4 µm. of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200 to 500 ANG., containing an aqueous solution in the nucleus.
[00308] [00308] In some embodiments, a liposome comprises cationic lipids. The term "cationic lipid" includes lipids and synthetic lipids with polar and non-polar domains and which are capable of being positively charged at or near physiological pH and that bind to polyanions, such as nucleic acids, and facilitate delivery of nucleic acids into cells. In some modalities, cationic lipids include saturated and unsaturated alkyl and alicyclic ethers and esters of amines, amides or derivatives thereof. In some embodiments, cationic lipids comprise straight chain alkyl, branched alkyl, alkenyl or any combination of the above. In some embodiments, cationic lipids contain from 1 to about 25 carbon atoms (for example,
[00309] [00309] Non-limiting examples of cationic lipids include polyethyleneimine, polyamidoamine star burst dendrimers (PAMAM), Lipofectin (a combination of DOTMA and DOPE), Lipofectase, LIPOFECTAMINE ™ (eg LIPOFECTAMINE ™ 2000), DOPE, cytofectin (Gilead Sciences, Gilead Sciences City, California), and Eufectins (JBL, San Luis Obispo, California). Exemplary cationic liposomes can be produced from N- [1- (2,3-dioleoloxy) -propyl] -N, N, N-trimethylammonium chloride (DOTMA), N- [1- (2,3- -N, N, N-trimethylammonium (DOTAP), 3β- [N- (N ′, N′-dimethylaminoethane) carbamoyl] cholesterol (DC-Chol), 2,3, - diiolyloxy-N - [ethyl 2 (sperminecarboxamido) trifluoroacetate], -N, N-dimethyl-1-propanamine (DOSPA), 1,2-dimyryloxypropyl-3-dimethyl-hydroxyethyl ammonium bromide; and dimethyldioctadecylammonium bromide (DDAB). Nucleic acids (for example, CELiD) can also be complex with, for example, poly (L-lysine) or avidin and lipids may or may not be included in this mixture, for example, sterile-poly (L-lysine).
[00310] [00310] In some embodiments, a ceDNA vector as described herein is delivered using a cationic lipid described in US Patent 8,158,601, or a polyamine compound or lipid as described in US Patent 8,034,376. D. Conjugates
[00311] [00311] In some embodiments, a ceDNA vector as described herein is conjugated (for example, covalently linked to an agent that increases cell uptake. An "agent that increases cell uptake" is a molecule that facilitates the transport of an acid nucleic acid through a lipid membrane. For example, a nucleic acid can be conjugated to a lipophilic compound (eg, cholesterol, tocopherol, etc.), a cell-penetrating peptide (CPP) (eg, penetratin, TAT, Syn1B, etc.), and polyamines (for example, spermine) .Other examples of agents that increase cell absorption are described, for example, in Winkler (2013). Oligonucleotide conjugates for therapeutic applications. .4 (7); 791-
[00312] [00312] In some embodiments, a ceDNA vector as described in this document is conjugated to a polymer (eg, a polymeric molecule) or a folate molecule (eg, folic acid molecule). Generally, delivery of conjugated nucleic acids to polymers is known in the art, for example, as described in WO2000 / 34343 and WO2008 / 022309. In some embodiments, a ceDNA vector as described herein is conjugated to a poly (amide) polymer, for example, as described by the US Patent
[00313] [00313] In some embodiments, a ceDNA vector as described herein is conjugated to a carbohydrate, for example, as described in US Patent 8,450,467.
[00314] [00314] Alternatively, nanocapsule formulations of a ceDNA vector, as described in this document, can be used. Nanocapsules can generally trap substances in a stable and reproducible manner. To avoid side effects due to intracellular polymeric overload, these ultrafine particles (sized around 0.1 µm) must be manipulated using polymers capable of being degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use. VIII. Delivery methods of ceDNA vectors
[00315] [00315] In some embodiments, a ceDNA vector can be delivered to a target cell in vitro or in vivo by various suitable methods. ceDNA vectors alone can be applied or injected. The ceDNA vectors can be delivered to a cell without the help of a transfection reagent or other physical means. Alternatively, ceDNA vectors can be delivered using any transfection reagent known in the art or another physical medium known in the art that facilitates the entry of DNA into a cell, for example, liposomes, alcohols, compounds rich in polylysine , compounds rich in arginine, calcium phosphate, microvesicles, microinjection, electroporation and the like.
[00316] [00316] In contrast, transductions with AAV vectors without capsid described here can efficiently target cell and tissue types that are difficult to transduce with conventional AAV virions using various delivery reagents.
[00317] [00317] In another embodiment, a vector of ceDNA is administered to the CNS (for example, the brain or the eye). The ceDNA vector can be introduced into the spinal cord, brainstem (oblong cord, pons), midbrain (hypothalamus, thalamus, epithalamus, pituitary gland)
[00318] [00318] In some modalities, the ceDNA vector can be administered to the desired region (or regions) of the CNS by any route known in the art, including, without limitation, intrathecal, intraointraocular, intracerebral, intraventricular, intravenous (for example, in the presence of sugar such as mannitol), intranasal, intra-aural, intra-intraocular delivery (for example, intravitreal, subretinal, anterior chamber) and periocular (for example, sub-Tenon region) as intra-muscular delivery with retrograde delivery to motor neurons.
[00319] [00319] In some modalities, the ceDNA vector is administered in a liquid formulation by direct injection (for example, stereotactic injection) in the desired region or compartment in the CNS. In other modalities, the ceDNA vector can be supplied by topical application in the desired region or by intranasal administration of an aerosol formulation. Ocular administration can be by topical application of liquid droplets. As an additional alternative, the ceDNA vector can be administered as a solid, slow-release formulation (see, for example, US Patent 7,201,898). In still additional modes, the ceDNA vector can be used for retrograde transport to treat, ameliorate and / or prevent diseases and disorders involving motor neurons (for example, amyotrophic lateral sclerosis (ALS); spinal muscular atrophy ( SMA), etc.). For example, the ceDNA vector can be delivered to muscle tissue from which it can migrate to neurons. VIII. Additional uses of ceDNA vectors
[00320] [00320] The ceDNA compositions and vectors provided here can be used to deliver a transgene for various purposes. In some embodiments, the transgene encodes a functional protein or RNA that is intended to be used for research purposes, for example, to create a somatic transgenic animal model that houses the transgene, for example, to study the function of the transgene product . In another example, the transgene encodes a functional protein or RNA that is intended to be used to create an animal model of disease. In some embodiments, the transgene encodes one or more peptides, polypeptides or proteins, which are useful for the treatment, prevention or amelioration of disease states or disorders in a mammal. The transgene can be transferred (for example, expressed in) to an individual in sufficient quantity to treat a disease associated with reduced expression, lack of expression or dysfunction of the gene. In some modalities, the transgene can be transferred to (for example, expressed in) an individual in sufficient quantity to treat a disease associated with increased expression, activity of the genetic product or inadequate positive regulation of a gene that the transgene suppresses or causes expression to be reduced. IX. Usage methods
[00321] [00321] The ceDNA vector of the invention can also be used in a method for delivering a nucleotide sequence of interest to a target cell. The method may, in particular, be a method for delivering a therapeutic gene of interest to a cell of an individual in need. The invention allows for the in vivo expression of a polypeptide, protein or oligonucleotide encoded by a therapeutic exogenous DNA sequence in cells of an individual so that therapeutic levels of the polypeptide, protein or oligonucleotide are expressed. These results are seen with the in vivo and in vitro modes of delivery of the ceDNA vector.
[00322] [00322] A method for delivering a nucleic acid of interest to a cell of an individual may comprise administering to said individual a cDNA vector of the invention that comprises said nucleic acid of interest. In addition, the invention provides a method for delivering a nucleic acid of interest to a cell of an individual in need, which comprises multiple administrations of the cDNA vector of the invention comprising said nucleic acid of interest. Since the ceDNA vector of the invention does not induce an immune response, such a multiple administration strategy will not be hampered by the response of the host's immune system against the ceDNA vector of the invention, contrary to what is observed with encapsulated vectors.
[00323] [00323] The nucleic acids of the ceDNA vector are administered in sufficient quantities to transfect cells from a desired tissue and provide sufficient levels of gene transfer and expression without undue adverse effects. Conventional and pharmaceutically acceptable routes of administration include, without limitation, intravenous (eg, in a liposome formulation), direct delivery to the selected organ (eg, intraportal delivery to the liver), intramuscular and other routes of administration parental. The administration routes can be combined, if desired.
[00324] [00324] The delivery of the ceDNA vector is not limited to one species of ceDNA vector. As such, in another aspect, several vectors of ce-DNA comprising different sequences of exogenous DNA can be delivered simultaneously or sequentially to the cell, tissue,
[00325] [00325] The invention also provides a method of treating a disease in an individual, which comprises introducing a therapeutically effective amount of a vector into a target cell in need (in particular a muscle cell or tissue) of the individual of ceDNA, optionally with a pharmaceutically acceptable carrier. Although the ceDNA vector can be introduced in the presence of a carrier, that vehicle is not necessary. The implanted ceDNA vector comprises a nucleotide sequence of useful interest in the treatment of the disease. In particular, the ceDNA vector may comprise a desired exogenous DNA sequence operably linked to control elements with the ability to direct the transcription of the desired polypeptide, protein or oligonucleotide encoded by the exogenous DNA sequence when introduced into the individual. The ceDNA vector can be administered by any suitable route, as provided above, and elsewhere in this document. X. Treatment methods
[00326] [00326] The technology described here also demonstrates methods for manufacturing, as well as methods of using the ceDNA vectors described in a variety of ways, including, for example, ex situ, in vitro and in vivo applications, methodologies diagnostic procedures, and / or gene therapy regimens.
[00327] [00327] This method provides a treatment method
[00328] [00328] Any transgene, can be delivered by ceDNA vectors, as described in this document. Transgenes of interest include nucleic acids encoding polypeptides or noncoding nucleic acids (eg, RNAi, miRs, etc.), preferably therapeutic (eg, for medical, diagnostic or veterinary use) or immunogenic polypeptides (eg, for vaccines).
[00329] [00329] In certain embodiments, the transgenes to be expressed by the ceDNA vectors described in this document will express or encode one or more polypeptides, peptides, ribozymes, peptide nucleic acids, siRNAs, RNAs, antisense oligonucleotides, antisense polynucleotides, antibodies, antigen-binding fragments, or any combination thereof.
[00330] [00330] In particular, the transgene can encode one or more therapeutic agents, including, without limitation, for example, protein (or proteins), polypeptide (or polypeptides), peptide (or peptides), enzyme (or enzymes), antibodies, antigen-binding fragments, as well as variants, and / or active fragments thereof, agonists, antagonists, mimetics for use in the treatment, prophylaxis, and / or amelioration of one or more symptoms of a disease, dysfunction, le - are, and / or disturbed. In one aspect, the disease, dysfunction, trauma, injury and / or disorder is a human disease, dysfunction, trauma, injury, and / or disorder.
[00331] [00331] As noted here, the transgene can encode a protein or peptide therapy, or therapeutic nucleic acid sequence or therapeutic agent, including, without limitation, one or more agonists, antagonists, anti-apoptosis factors, inhibitors, receptors , cytokines, cytotoxins, erythropoietic agents, glycoproteins, growth factors, receptor growth factor, hormones, receptor hormone, interferons, interleukins, interleukin receptors, neural growth factors, neuroactive peptides, neuroactive peptide receptors , proteases, protease, protein decarboxylase inhibitors, protein kinases, protein kinase inhibitors, enzymes, protein binding receptors, protein transport or one or more inhibitors thereof, serotonin receptors, or one or more absorption inhibitors thereof , serpins, serpin receptors, tumor eliminators, diagnostic molecules, chemotherapeutic agents, agents, quote toxins, or any combination of them.
[00332] [00332] In some modalities, a transgene in the expression cassette, expression construct or ceDNA vector described here can be codon-optimized for the host cell. As used herein, the term "codon optimization" or "codon optimization" refers to the process of modifying a nucleic acid sequence for enhanced expression in the vertebrate cells of interest, for example, mouse or human ( for example, humanized), replacing at least one, more than one or a significant number of codons in the native sequence (for example, a prokaryotic sequence) with codons that are more often or more frequently used in the genes of that vertebrate. Several species exhibit a particular bias for certain codons of a particular amino acid. Typically, codon optimization does not alter the amino acid sequence of the original translated protein. Optimized codons can be determined using, for example, Aptagen's Gene Forge® codon optimization platform and personalized genetic synthesis (Aptagen, Inc.) or another publicly available database.
[00333] [00333] In some embodiments, the ceDNA vector expresses the transgene in a host cell in question. In some ways, the host cell in question is a human host cell, including, for example, blood cells, stem cells, hematopoietic cells, CD34 + cells, liver cells, cancer cells, vascular cells, muscle cells, pancreatic cells, neural, eye or retinal cells, epithelial or endothelial cells, dendritic cells, fibroblasts or any other cell of mammalian origin, including, without limitation, liver cells (ie, liver), lung cells , cardiac cells, pancreatic cells, intestinal cells, diaphragmatic cells, renal (ie kidney) cells, neural cells, blood cells, bone marrow cells, or any one or more tissues selected from an individual for which gene therapy is contemplated . In one aspect, the individual cell host is a human cell host.
[00334] [00334] This document describes ceDNA vector compositions and formulations that include one or more of the ceDNA vectors of the present invention together with one or more buffers,
[00335] [00335] Another aspect of the technology described in the present document provides a method for providing an individual in need of it a diagnostic or therapeutically effective amount of a ceDNA vector, wherein the method comprising providing to a cell, tissue or organ of an individual in need of it, an amount of the ceDNA vector as described in this document; and for an effective time to allow expression of the transgene from the ceDNA vector thus providing the individual with a diagnostic or a therapeutically effective amount of the protein, peptide, nucleic acid expressed by the ceDNA vector. In an earlier aspect, the individual is a human being.
[00336] [00336] Another aspect of the technology described in this document provides a method to diagnose, prevent, treat, or improve at least one or more symptoms of a disease, a disorder, a dysfunction, an injury, an abnormal condition , or trauma, in an individual. In a global and general sense, the method includes at least the step of administering to an individual in need of one or more of the described ceDNA vectors, in an amount and for a time sufficient to diagnose, prevent, treat or improve the one or more symptoms of the disease, disorder, dysfunction, injury, abnormal condition, or trauma to the subject. In an earlier aspect, the individual is a human being.
[00337] [00337] Another aspect is the use of the ceDNA vector as a tool to treat or reduce one or more symptoms of a disease or disease states. There are several inherited diseases in which defective genes are known and generally fall into two classes: deficiency states, usually enzymes, generally recessively inherited, and unbalanced states, which may involve regulatory or structural proteins, and which are typically, but not always, inherited in a dominant manner. For diseases of the deficient state, ceDNA vectors can be used to deliver transgenes to bring a normal gene to the affected tissues for replacement therapy, as well as, in some modalities, to create animal models for the disease using mutations. antisense. For unbalanced disease states, ceDNA vectors can be used to create a disease state in a model system, which can be used in efforts to combat the disease state. Thus, the vectors and methods of ceDNA described here allow the treatment of genetic diseases. As used herein, a disease state is treated by partially or totally remedying the disability or imbalance that causes the disease or makes it more severe.
[00338] [00338] In general, the ceDNA vector as described herein can be used to deliver any transgene to treat, prevent or ameliorate the symptoms associated with any disorder related to gene expression. Illustrative disease states include, but are not limited to: cystic fibrosis (and other lung diseases), hemophilia A, haemophilia B, thalassemia, anemia and other blood disorders, AIDS, Alzheimer's disease, Parkinson's disease, Huntington, amyotrophic lateral sclerosis, epilepsy and other neurological disorders, cancer, diabetes mellitus, muscular dystrophies (eg, Duchenne, Becker), Hurler's disease, adenosine deaminase deficiency, metabolic defects, degenerative retinal diseases (and other eye diseases), mitochondriopathies (eg, Leber's hereditary optic neuropathy (LHON), Leigh's syndrome and sclerotic encephalopathy
[00339] [00339] In some modalities, the ceDNA vector described here can be used to treat, improve and / or prevent a disease or disorder caused by mutation in a gene or genetic product. Exemplary diseases or disorders that can be treated with ceDNA vectors include, but are not limited to, metabolic diseases or disorders (eg, Fabry disease, Gaucher disease, phenylketonuria (PKU), storage disease glycogen); diseases or disorders of the urea cycle (eg, ornithine transcarbamylase (OTC) deficiency); lysosomal storage diseases or disorders (for example, metachromatic leukodystrophy (DLM), mucopolysaccharidosis type II (MPSII; Hunter syndrome)); liver diseases or disorders (for example, progressive familial intrahepatic cholestasis (PFIC); blood disorders or disorders (for example, haemophilia (A and B), thalassemia and anemia); cancers and tumors and diseases or genetic disorders (for example , cystic fibrosis).
[00340] [00340] As yet another aspect, a ceDNA vector as described herein can be employed to provide a heterologous nucleotide sequence in situations where it is desirable to regulate the level of expression of the transgene (for example, transgenes that encode hormones or growth factors, as described in this document).
[00341] [00341] Therefore, in some embodiments, the cDNA vector described here can be used to correct an abnormal level and / or function of a genetic product (for example, an absence or defect in a protein) that results in the disease or disorder. The ceDNA vector can produce a functional protein and / or modify protein levels to alleviate or reduce symptoms resulting from or confer benefits to a specific disease or disorder caused by the absence or defect in the protein. For example, treatment of OTC deficiency can be achieved through the production of functional OTC enzyme; the treatment of hemophilia A and B can be achieved by modifying the levels of factor VIII, factor IX and factor X; the treatment of PKU can be achieved by modifying the levels of the enzyme phenylalanine hydroxylase; the treatment of Fabry or Gaucher disease can be achieved through the production of functional alpha galactosidase or beta glucocerebrosidase, respectively; treatment of MLD or MPSII can be achieved by producing functional arylsulfatase A or iduronate-2-sulfatase, respectively; the treatment of cystic fibrosis can be achieved by producing a functional transmembrane conductance regulator for cystic fibrosis; the treatment of glycogen storage disease can be achieved by restoring the functional function of the G6Pase enzyme; and the treatment of PFIC can be achieved by producing the functional genes ATP8B1, ABCB11, ABCB4 or TJP2.
[00342] [00342] In alternative embodiments, the ceDNA vectors as described in this document can be used to deliver an antisense nucleic acid to a cell in vitro or in vivo. For example, where the transgene is an RNAi molecule, the expression of antisense nucleic acid or RNAi in the target cell decreases the expression of a specific protein by the cell. Therefore, transgenes that are RNAi molecules or antisense nucleic acids can be administered to decrease the expression of a specific protein in an individual in need. Antisense nucleic acids can also be administered to cells in vitro to regulate cell physiology, for example, to optimize cell or tissue culture systems.
[00343] [00343] In some embodiments, exemplifying transgenes codified by the ceDNA vector include, without limitation: X, lysosomal enzymes (eg, hexosaminidase A, associated with Tay-Sachs disease or sulfatase iduronate, associated with Hunter / MPS II), erythropoietin, angiostatin, endostatin, superoxide dismutase, globin, leptin, catalase, tyrosine hydroxylase, as well as cytokines (for example, an interferon, interferon-β, interferon-γ, inter-γ, inter - leucine-2, interleukin-4, interleukin 12, granulocyte and macrophage colony stimulating factor, lymphotoxin and the like), peptide and hormone growth factors (eg, somatotropin, insulin, growth factors similar to insulin 1 and 2, platelet-derived growth factor (PDGF), epidermal growth factor (EGF), fibroblast growth factor (FGF), nerve growth factor (NGF), neurotrophic factor 3 and 4, brain-derived neurotrophic (B DNF), glial-derived growth factor (GDNF), transforming growth factor α and β and the like), receptors (for example, tumor necrosis factor receptors). In some exemplifying embodiments, the transgene encodes a specific monoclonal antibody for one or more desired targets. In some exemplifying modalities, more than one transgene is encoded by the ceDNA vector. In some exemplifying embodiments, the transgene encodes a fusion protein that comprises two different polypeptides of interest. In some embodiments, the transgene encodes an antibody, including an entire antibody or antibody fragment, as defined herein. In some embodiments, the antibody is an antigen-binding domain or an immunoglobulin variable domain sequence, as defined herein. Other illustrative transgene sequences encode suicide gene products (thymine kinase, cytosine deaminase, diphtheria toxin, cytochrome P450, deoxycytidine kinase and tumor necrosis factor), proteins that confer resistance to a drug used in cancer therapy and tumor suppressor gene products.
[00344] [00344] In a representative modality, the transgene expressed by the ceDNA vector can be used for the treatment of muscular dystrophy in an individual in need, in which the method comprises: administering an effective amount of treatment, improvement or prevention of the vector of ceDNA described herein, wherein the ceDNA vector comprises a heterologous nucleic acid encoding dystrophin, a mini-dystrophin, a micro-dystrophin, myostatin propeptide, folistatin, soluble type II activin receptor, IGF-1, polypeptides anti-inflammatory drugs such as the dominant Ikappa B mutant, sarcospan, utrophin, a micro-dystrophin, laminin-α2, α-sarcoglycan, β-sarcoglycan, γ-sarcoglycan, δ-sarcoglycan, IGF-1, an antibody or fragment of antibody against myostatin or myostatin propostide and / or RNAi against myostatin. In particular modalities, the ceDNA vector can be administered to the skeletal, diaphragm and / or cardiac muscle, as described elsewhere in this document.
[00345] [00345] In some embodiments, the ceDNA vector can be used to deliver a transgene to the skeletal, cardiac or diaphragm muscle, to produce a polypeptide (for example, an enzyme) or functional RNA (for example, RNAi , microRNA, antisense RNA) that normally circulates in the blood or for systemic delivery to other tissues to treat, improve and / or prevent a disorder (eg, a metabolic disorder, such as diabetes (eg, insulin), hemophilia (for example, VIII), a mucopolysaccharide disorder (for example, Sly syndrome, Hurler syndrome, Scheie syndrome, Hurler-Scheie syndrome, Hunter syndrome,
[00346] [00346] In other modalities, the ceDNA vector as described in this document can be used to deliver a transgenic in a method of treatment, improvement and / or prevention of a metabolic disorder in an individual in need. Illustrative metabolic disorders and transgenes encoding polypeptides are described in this document. Optionally, the polypeptide is secreted (for example, a polypeptide that is a secreted polypeptide in its native state or that has been manipulated to be secreted, for example, by operable association with a secretory signal sequence, as is known in the art) .
[00347] [00347] Another aspect of the invention relates to a method of treatment, improvement and / or prevention of congenital heart failure or PAD in an individual in need of it, in which the method comprises the administration of a vector of ceDNA as described herein to a mammalian individual, in which the ceDNA vector comprises a transgene encoding, for example, a sarcoplasmic endoreticulum Ca2 + -ATPase (SERCA2a), an angiogenic factor, phosphatase I (I-1 inhibitor) ), RNAi against phospholamban; a phospholamban inhibitory or dominant negative molecule, such as phospholamban S16E, a digital zinc protein that regulates the phospholamban gene, β2-adrenergic receptor, beta.2-adrenergic kinase (BARK), PI3 kinase, calsarcan, a. chi receptor inhibitor
[00348] [00348] The ceDNA vectors as described herein can be administered to an individual's lungs by any suitable means, optionally by administering an aerosol suspension of respirable particles comprising the ceDNA vectors, which the individual inhaled. Breathable particles can be liquid or solid. Aerosols of liquid particles comprising the ceDNA vectors can be produced by any suitable means, such as with a pressure-driven aerosol nebulizer or an ultrasonic nebulizer, as is known to those skilled in the art. See, for example, Patent No. 4,501,729. Solid particle aerosols comprising the ceDNA vectors can also be produced with any solid particle drug aerosol generator, by techniques known in the pharmaceutical art.
[00349] [00349] In some embodiments, ceDNA vectors can be administered to the tissues of the CNS (for example, brain, eye). In particular embodiments, the ceDNA vectors described herein can be administered to treat, ameliorate or prevent CNS diseases, including genetic disorders, neurodegenerative disorders, psychiatric disorders and tumors. Illustrative CNS diseases include, but are not limited to, Alzheimer's disease, Parkinson's disease, Huntington's disease, Canavan's disease, Leigh's disease, Refsum's disease, Tourette's syndrome, primary lateral sclerosis, amyotrophic lateral sclerosis, progressive muscle atrophy, Pick's disease, muscular dystrophy, multiple sclerosis, myasthenia gravis, Binswanger's disease,
[00350] [00350] Eye disorders that can be treated, improved or prevented with the cDNA vectors of the invention include ophthalmic disorders involving the retina, posterior tract and optic nerve (e.g., retinitis pigmentosa, diabetic retinopathy and other diseases degenerative retina, uveitis, age-related macular degeneration, glaucoma). Many ophthalmic diseases and disorders are associated with one or more of the three types of indications: (1) angiogenesis, (2) inflammation and (3) degeneration. In some embodiments, the ceDNA vector as described in this document can be used to provide antiangiogenic factors; anti-inflammatory factors; factors that delay cell degeneration, promote cell savings or promote growth and combinations of previous cells. Diabetic retinopathy, for example, is characterized by angiogenesis. Diabetic retinopathy can be treated by administering one or more antiangiogenic factors, intraocularly (for example, in the vitreous) or periocularly (for example, in the sub-Tenon region). One or more neurotrophic factors can also be co-located
[00351] [00351] In some embodiments, inflammatory eye diseases or disorders (e.g., uveitis) can be treated, improved, or prevented by the cDNA vectors of the invention. One or more anti-inflammatory factors can be expressed by intra-intraocular administration (for example, vitreous or anterior chamber) of the ceDNA vector, as described in this document. In other embodiments, eye diseases or disorders characterized by degeneration of the retina (e.g., retinitis pigmentosa) can be treated, improved, or prevented by the cDNA vectors of the invention. intraocular (eg, vitreal administration) of the ceDNA vector, as described in this document, which encodes one or more neurotrophic factors, can be used to treat these diseases based on retinal degeneration. In some embodiments, diseases or disorders involving angiogenesis and retinal degeneration (eg, age-related macular degeneration) can be treated with the ceDNA vectors of the invention. Age-related macular degeneration can be treated by administering the ceDNA vector, as described in this document, which encodes one or more neurotrophic factors intraocularly (for example, vitreous) and / or one or more antigenic factors intraocularly or periocularly ( for example, in the
[00352] [00352] In other modalities, the ceDNA vector as described in this document can be used to treat seizures, for example, to reduce the onset, incidence or severity of seizures. The effectiveness of a therapeutic treatment for seizures can be assessed by behavioral (for example, tremors, ticks in the eyes or mouth) and / or electrographic (most seizures have marked electrographic abnormalities). Thus, the ceDNA vector as described in this document can also be used to treat epilepsy, which is marked by multiple seizures over time. In a representative embodiment, somatostatine (or an active fragment thereof) is administered to the brain using the ceDNA vector as described in this document to treat a pituitary tumor. According to this modality, the ceDNA vector as described in the present document encoding somatostatin (or an active fragment thereof) is administered by microinfusion in the pituitary. Likewise, this treatment can be used to treat acromegaly (abnormal pituitary growth hormone secretion). The nucleic acid (for example, Genbank accession J00306) and the amino acid (for example, Genbank accession P01166) contain active processed peptides somatostatin-28 and somatostatin-14) somatostatine sequences, as they are known
[00353] [00353] Another aspect of the invention relates to the use of a ceDNA vector as described herein to produce antisense RNA, RNAi or other functional RNA (e.g., a ribozyme) for systemic delivery to an individual in vivo. Therefore, in some modalities, the ceDNA vector may comprise a transgene that encodes an antisense nucleic acid, a ribozyme (for example, as described in US Patent 5,877,022), RNAs that affect transcription mediated by spliceosome (see Puttaraju et al., (1999) Nature Biotech. 17: 246; US 6,013,487; US 6,083,702), interfering RNAs (RNAi) that mediate gene silencing (see Sharp et al., (2000) Science 287 : 2431) or other untranslated RNAs, such as "guide" RNAs (Gorman et al., (1998) Proc. Nat. Acad. Sci. USA 95: 4929; Patent in US 5,869,248 by Yuan et al.) , and the like.
[00354] [00354] In some embodiments, the ceDNA vector may also comprise a transgene that encodes a reporter polypeptide (for example, an enzyme such as Green Fluorescent Protein, or alkaline phosphatase). In some embodiments, a transgene that encodes a reporter protein useful for experimental or diagnostic purposes is selected from any of the following options: β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, fluorescent protein green (GFP), chloramphenicol acetyltransferase (CAT), luciferate and others well known in the art. In some respects, ceDNA vectors that comprise a transgene encoding a reporter polypeptide can be used for diagnostic purposes or as markers of the activity of the ceDNA vector in the individual to which they are administered.
[00355] [00355] In some modalities, the ceDNA vector can comprise
[00356] [00356] In some embodiments, the ceDNA vector may comprise a transgene that can be used to express an immunogenic polypeptide in an individual, for example, for vaccination. The transgene can encode any immunogen of interest known in the art, including, without limitation, human immunodeficiency virus immunogens, influenza viruses, gag proteins, tumor antigens, cancer antigens, bacterial antigens, viral antigens and the like. XI. Administration
[00357] [00357] In particular modalities, more than one administration (for example, two, three, four or more administrations) can be used to reach the desired level of gene expression during a period of several intervals, for example, daily, weekly , monthly, annually etc.
[00358] [00358] Exemplary modes of administration of the ceDNA vector described in this document include oral, rectal, transmucosal, intranasal, inhalation (eg, aerosol), buccal (eg, sublingual), vaginal, intrathecal, intraocular, transdermal, intra-trothelial, uterus (or egg), parenteral (eg, intravenous, subcutaneous, intradermal, intracranial, intramuscular [including administration to skeletal muscle, diaphragm and / or cardiac], intrapleural, intracerebral and intraarticular), topical (for example, on both skin and mucosal surfaces, including airway surfaces and transdermal administration), intralymphatic and the like, as well as direct injection of tissues or organs (eg, liver, eye, skeletal muscle, cardiac muscle, diaphragm or brain muscle
[00359] [00359] The administration of the ceDNA vector can be anywhere in an individual, including, without limitation, a site selected from the group consisting of the brain, a skeletal muscle, a smooth muscle, the heart, the diaphragm, the airway epithelium, liver, kidney, spleen, pancreas, skin and eyes. The administration of the ceDNA vector can also be in a tumor (for example, in a tumor or in a lymph node or close to it). The most appropriate route in any case will depend on the nature and severity of the condition to be treated, improved and / or prevented and the nature of the specific ceDNA vector being used. In addition, ceDNA allows you to administer more than one transgene in a single vector or multiple vectors of ceDNA (for example, a cocktail of ceDNA).
[00360] [00360] Administration of the ceDNA vector disclosed herein to the skeletal muscle according to the present invention includes, but is not limited to, administration to the skeletal muscle in the limbs (e.g. upper arm, lower arm, lower leg and / or upper leg), back, neck, head (for example, tongue), chest, abdomen, pelvis / perineum and / or digits. CeDNA as described in this vector can be delivered to skeletal muscle by intravenous administration, intra-arterial administration, intraperitoneal administration, limb perfusion ((optionally, isolated limb perfusion of a leg and / or arm; see, for example, Arruda et al., (2005) Blood 105: 3458-3464) and / or direct intramuscular injection In particular modalities, the ceDNA vector as described in this document is administered to a limb (arm and / or leg) of an individual (eg, a subject with muscular dystrophy such as DMD) by limb perfusion, optionally isolated limb perfusion (eg, intravenously or intra-articular administration. In modalities, the ceDNA vector as described in this document can be administered without the use of "hydrodynamic" techniques.
[00361] [00361] The administration of the ceDNA vector, as described in this document to the cardiac muscle, includes administration in the left atrium, right atrium, left ventricle, right ventricle and / or septum. The ceDNA vector, as described in this document, can be delivered to the heart muscle by intravenous administration, intra-arterial administration such as intra-aortic administration, direct cardiac injection (for example, in the left atrium, right atrium, ventricle left ventricle) and / or coronary artery perfusion. Administration to the diaphragm muscle can be by any suitable method, including intravenous administration, intra-arterial administration and / or intraperitoneal administration. Administration to smooth muscle can be by any suitable method, including intravenous administration, intra-arterial administration and / or intraperitoneal administration. In one embodiment, the administration can be in endothelial cells present in the nearby muscle, and / or in the smooth muscle.
[00362] [00362] In some embodiments, a ceDNA vector according to the present invention is administered to skeletal muscle, diaphragm muscle and / or cardiac muscle (for example, to treat, improve and / or prevent muscular dystrophy or heart disease (for example , PAD or congestive disease) heart failure). A. Ex vivo treatment
[00363] [00363] In some embodiments, cells are removed from an individual, a ceDNA vector is introduced into it and the cells are then replaced again in the individual. Methods of removing cells from the subject for ex vivo treatment, followed by introduction to the subject, are known in the art (see, for example, U.S. Patent No. 5,399,346; the description of which is incorporated herein in its entirety). Alternatively, a ceDNA vector is introduced into another individual's cells, cultured cells or cells of any
[00364] [00364] Cells transduced with a ceDNA vector are preferably administered to the individual in a "therapeutically effective amount" in combination with a pharmaceutical carrier. Those skilled in the art will understand that the therapeutic effects need not be complete or curative, as long as some benefit is provided to the individual.
[00365] [00365] In some embodiments, the ceDNA vector can encode a transgene (sometimes called a heterologous nucleotide sequence) that is any polypeptide that is desirably produced in a cell in vitro, ex vivo or in vivo. For example, in contrast to the use of ceDNA vectors in a treatment method discussed here, in some embodiments, ceDNA vectors can be introduced into cultured cells and the expressed gene product isolated from them, for example, for the production of antigens or vaccines.
[00366] [00366] The ceDNA vectors can be used in veterinary and medical applications. Subjects suitable for ex vivo gene delivery methods, as described above, include birds (for example, chickens, ducks, geese, quails, turkeys and pheasants) and mammals (for example, humans, cattle, sheep, goats, horses, felines, canines and lagomorphs), with mammals being preferred. Human beings are preferred. Human beings include newborns, babies, young people and adults.
[00367] [00367] One aspect of the technology described in this document relates to a method of delivering a transgene to a cell. Typically, for in vitro methods, the ceDNA vector can be introduced into the cell using the methods as described in the present documents, as well as other methods known in the art. The ceD- vectors
[00368] [00368] In vivo and / or in vitro tests can optionally be used to help identify ideal dosage ranges for use. The dose that needs to be used in the formulation will also depend on the route of administration and the severity of the condition, and should be decided according to the judgment of the technical individual on the subject and on the circumstances of each subject. Effective doses can be extrapolated from dose-response curves derived from in vitro test systems or from an animal model.
[00369] [00369] A ceDNA vector is administered in sufficient quantities to transfect the cells of a desired tissue and provide sufficient levels of gene transfer and expression without undue adverse effects. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, those described above in the "Administration" section, such as direct delivery to the selected organ (eg, intraportal delivery to the liver), oral, inhalation (including intranasal and administration intratracheal), intraocular, intravenous, intramuscular, subcutaneous, intradermal, intratumor and other parental routes of administration. Administration routes can be combined, if desired.
[00370] [00370] The dose of the amount of a cDNA vector required to achieve a specific "therapeutic effect" will vary based on several factors, including, but not limited to: the route of nucleic acid administration, the level of gene expression or RNA needed to
[00371] [00371] The dosage regimen can be adjusted to provide the optimal therapeutic response. For example, the oligonucleotide can be administered repeatedly, for example, several doses can be administered daily or the dose can be proportionally reduced as indicated by the requirements of the therapeutic situation. A person skilled in the art will be able to readily determine appropriate doses and administration schedules of the oligonucleotides in question, whether the oligonucleotides are to be administered to cells or individuals.
[00372] [00372] A "therapeutically effective dose" will fall in a relatively wide range that can be determined through clinical trials and will depend on the specific application (neural cells will require very small amounts, whereas systemic injection would require large amounts). For example, for direct in vivo injection into the skeletal or cardiac muscle of a human subject, a therapeutically effective dose will be on the order of from about 1 μg to 100 g of the ceDNA vector. If exosomes or microparticles are used to deliver the ceDNA vector, then a therapeutically effective dose can be determined experimentally, but it is expected to deliver from 1 μg to about 100 g of vector.
[00373] [00373] The formulation of pharmaceutically acceptable excipients and carrier solutions is well known to those skilled in the art, as is the development of dosage and treatment regimes.
[00374] [00374] For in vitro transfection, an effective amount of a ceDNA vector to be delivered to cells (1X106 cells) will be in the range of 0.1 to 100 μg ceDNA vector, preferably 1 to 20 μg, and more preferably 1 to 15 μg or 8 to 10 μg. Larger cDNA vectors will require higher doses. If exosomes or microparticles are used, an effective dose in vitro can be determined experimentally, but it would be intended to provide generally the same amount of the ceDNA vector.
[00375] [00375] Treatment may involve the administration of a single dose or several doses. In some embodiments, more than one dose can be administered to an individual; in fact, multiple doses can be administered as needed, due to the fact that the ceDNA vector triggers does not elicit an immune response from the anticapsid host due to the absence of a viral capsid. As such, a person skilled in the art can quickly determine an appropriate number of doses. The number of doses administered can, for example, be in the range of 1 to 100, preferably 2 to 20 doses.
[00376] [00376] Without wishing to stick to any specific theory, the lack of typical antiviral immune response caused by the administration of a ceDNA vector, as described in the description (ie, the absence of capsid components), allows the vector of ceDNA is administered to a host on several occasions. In some embodiments, the number of occasions when a heterologous nucleic acid is delivered to an individual varies from 2 to 10 times (for example, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times) . In some embodiments, a ceDNA vector is delivered to an individual more than 10 times.
[00377] [00377] In some embodiments, a dose of a ceD-NA vector is administered to an individual no more than once a calendar day (for example, a 24-hour period). In some modalities, a dose of a vector of ceDNA is administered to an individual no more than once every 2, 3, 4, 5, 6 or 7 consecutive days. In some embodiments, a dose of a vector of ceDNA is administered to an individual no more than once a calendar week (for example, 7 calendar days). In some embodiments, a dose of a vector of ceDNA is administered to an individual no more than twice a week (for example, once in a period of two civic weeks). In some embodiments, a dose of a ceDNA vector is administered to an individual no more than once a calendar month (for example, once in 30 calendar days). In some embodiments, a dose of a ceDNA vector is administered to an individual no more than once every six months. In some embodiments, a dose of a ceDNA vector is administered to an individual no more than once per calendar year (for example, 365 days or 366 days in a leap year). C. Unit dosage forms
[00378] [00378] In some embodiments, pharmaceutical compositions can be conveniently presented in unit dosage form. A unit dosage form will typically be adapted to one or more routes of administration specific to the pharmaceutical composition. In some embodiments, the unit dosage form is adapted for administration by inhalation. In some embodiments, the unit dosage form is adapted for administration by a vaporizer. In some embodiments, the unit dosage form is adapted for administration by a nebulizer. In some modes, the unit dosage form is adapted for administration by an aerosolizer. In some modalities, the unit dosage form is adapted for oral administration, for oral administration or for sublingual administration. In some modalities, the unit dosage form is adapted for intravenous, intramuscular or subcutaneous administration. In some modalities, the unit dosage form is adapted for intrathecal or intra-cerebroventricular administration. In some embodiments, the pharmaceutical composition is formulated for topical administration. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be the amount of the compound that produces a therapeutic effect. XII. Various applications
[00379] [00379] The ceDNA compositions and vectors provided herein can be used to provide a transgene for various purposes, as described above. In some embodiments, the transgene encodes a functional protein or RNA that is intended to be used for research purposes, for example, to create a somatic transgenic animal model that houses the transgene, for example, to study the function of the transgene product. In another example, the transgene encodes a protein or functional RNA that is intended to be used to create an animal model of disease.
[00380] [00380] In some embodiments, the transgene encodes one or more peptides, polypeptides or proteins, which are useful for treating, ameliorating or preventing disease states in a mammal. The transgene can be transferred (for example, expressed in) to a patient in sufficient quantity to treat a disease associated with reduced expression, lack of expression or dysfunction of the gene.
[00381] [00381] In some embodiments, ceDNA vectors are intended for use in diagnostic and screening methods, in which a transgene is expressed in a transient or stable manner in a cell culture system or, alternatively, in a transgenic animal model.
[00382] [00382] Another aspect of the technology described in this document
[00383] [00383] Furthermore, the present invention provides compositions, as well as therapeutic and / or diagnostic kits that include one or more described ceDNA vectors or ceDNA compositions, formulated with one or more additional ingredients or prepared with one or more instructions for its use.
[00384] [00384] A cell to be administered to the ceDNA vector, as disclosed in this document, can be of any type, including, without limitation, neural cells (including cells of the central and peripheral nervous systems, in particular, cells brain cells), lung cells, retinal cells, epithelial cells (eg, respiratory and intestinal epithelial cells), muscle cells, dermal cells, pancreatic cells (including islet cells), liver cells, myocardial cells, bone cells (eg, bone marrow stem cells), hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, germ cells and the like. Alternatively, the cell can be any parent cell. As an additional alternative, the cell can be a stem cell (for example, neural stem cell, liver stem cell). As an additional alternative, the cell can be a cancer or tumor cell. In addition, the cells can be of any species of origin, as indicated above.
[00385] [00385] In some embodiments, the present application can be defined in any of the following paragraphs:
[00386] [00386] 1A. A ceDNA vector comprising: an expression cassette comprising a cis regulatory element,
[00387] [00387] 2A. The DNA vector of paragraph 1A, where the DNA vector has a linear and continuous structure.
[00388] [00388] 3A. The DNA vector of any of paragraphs 1A-2A, wherein the post-transcriptional regulatory element comprises a post-transcriptional WHP (WPRE) regulatory element.
[00389] [00389] 4A. The DNA vector of any one of paragraphs 1A-3A, wherein the expression cassette further comprises a cloning site.
[00390] [00390] 5A. The DNA vector of any of paragraphs 1A to 4A, wherein the expression cassette comprises a promoter selected from the group consisting of CAG promoter, AAT promoter, LP1 promoter and EF1a promoter.
[00391] [00391] 6A. The DNA vector of paragraph 1A, wherein the expression cassette comprises polynucleotides of SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9.
[00392] [00392] 7A. The DNA vector of any one of paragraphs 1A-6A, wherein the expression cassette further comprises a cloning site and an exogenous sequence inserted into the cloning site.
[00393] [00393] 8A. The DNA vector of paragraph 7A, wherein the exogenous sequence comprises at least 2,000 nucleotides.
[00394] [00394] 9A. The DNA vector of paragraph 7A, where the exogenous sequence encodes a protein.
[00395] [00395] 10A. The DNA vector of paragraph 7A, wherein the exogenous sequence encodes a reporter protein.
[00396] [00396] 11A. Cell that comprises the DNA vector of any of paragraphs 1A-10A.
[00397] [00397] 12A. The cell in paragraph 11A, which further comprises a replication protein selected from the group consisting of: AAV Rep 78, AAV Rep 68, AAV Rep52 and AAV Rep 40.
[00398] [00398] 13A. The cell in paragraph 12A, wherein said replicating protein is encoded by a helper virus.
[00399] [00399] 14A. The cell of any one of paragraphs 11A-13A, wherein the cell lacks a gene that encodes an AAV capsid protein.
[00400] [00400] 15A. A pharmacologically active ingredient that comprises the DNA vector of any of paragraphs 1A-10A and, optionally, an excipient.
[00401] [00401] 16A. Method for delivering an exogenous sequence to a cell, which comprises the step of: introducing said DNA vector from any of paragraphs 1A-10A to said cell.
[00402] [00402] 17A. The method of paragraph 16A, wherein said step of introducing the DNA vector comprises hydrodynamic injection.
[00403] [00403] 18A. Method for preparing a DNA vector comprising the steps of: introducing into a cell a nucleic acid construct or a virus comprising: an expression cassette comprising a cis regulatory element, in which the cis regulatory element is selected from group consisting of a post-transcriptional regulatory element and a signal
[00404] [00404] 19A. The method of paragraph 18A, in which the DNA vector has a linear and continuous structure.
[00405] [00405] 20A. The method of any of paragraphs 18A-19A, wherein the post-transcriptional regulatory element comprises a post-transcriptional WHP (WPRE) regulatory element.
[00406] [00406] 21A. The method of any of paragraphs 18A-20A, wherein the expression cassette further comprises a promoter selected from the group consisting of the CAG promoter, AAT promoter, LP1 promoter and EF1a promoter.
[00407] [00407] 22A. The method of paragraph 18, wherein said expression cassette comprises polynucleotides of SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9.
[00408] [00408] 23A. The method of any of paragraphs 18A-22A, wherein said expression cassette further comprises an exogenous sequence.
[00409] [00409] 24A. The method of paragraph 23A, wherein the exogenous sequence comprises at least 2,000 nucleotides.
[00410] [00410] 25A. The method of paragraph 23A, wherein the exogenous sequence encodes a protein.
[00411] [00411] 26A. The method of paragraph 23A, wherein the exogenous sequence encodes a reporter protein.
[00412] [00412] 27A. The method of any of paragraphs 18A-26A, wherein said cell is an insect cell.
[00413] [00413] 28A. A DNA vector generated by the method of any of paragraphs 18 to 27.
[00414] [00414] 29A. A cell to produce a DNA vector comprising: a first polynucleotide comprising: an expression cassette comprising a cis regulatory element, in which the cis regulatory element is selected from the group consisting of a post-transcriptional regulatory element and a BGH poly-A signal; an upstream wild type ITR (5'-end) of the expression cassette, wherein the wild type ITR comprises a polynucleotide of SEQ ID NO: 51; and a modified ITR downstream (3'-end) of the expression cassette, wherein the modified ITR comprises a polynucleotide of SEQ ID NO: 2; and a second polynucleotide encoding a replication protein selected from the group consisting of AAV78, AAV52, AAV Rep68 and AAV Rep 40, wherein said cell is devoid of a gene encoding an AAV capsid protein.
[00415] [00415] 30A. The cell in paragraph 29A, wherein the post-transcriptional regulatory element comprises a post-transcriptional WHP (WPRE) regulatory element.
[00416] [00416] 31A. The cell of any one of paragraphs 29A-30A, wherein said cell is an insect cell.
[00417] [00417] 32A. A DNA vector produced from the cell of any one of paragraphs 29A-31A, by replicating said first polynucleotide.
[00418] [00418] 33A. Polynucleotide to generate a DNA vector comprising: an expression cassette comprising a cis regulatory element, in which the cis regulatory element is selected from the group consisting of a post-transcriptional regulatory element and a poly-A BGH signal; an upstream wild type ITR (5'-end) of the expression cassette, wherein the wild type ITR comprises a polynucleotide of SEQ ID NO: 51; and a modified ITR downstream (3'-end) of the expression cassette, wherein the modified ITR comprises a polynucleotide of SEQ ID NO: 2.
[00419] [00419] 34A. The polynucleotide of paragraph 33A, wherein the post-transcriptional regulatory element comprises a post-transcriptional regulatory element WHP (WPRE).
[00420] [00420] 35A. The polynucleotide of any one of paragraphs 33A-34A, where the polynucleotide is in a plasmid, a bacmid or a baculovirus.
[00421] [00421] 36A. The polynucleotide of any one of paragraphs 33A-35A, which further comprises an exogenous sequence.
[00422] [00422] 37A. The polynucleotide of paragraph 36A, where the exogenous sequence comprises at least 2,000 nucleotides.
[00423] [00423] 38A. The polynucleotide in paragraph 36A, where the exogenous sequence encodes a protein.
[00424] [00424] 39A. The polynucleotide in paragraph 36A, where the exogenous sequence encodes a reporter
[00425] [00425] 40A. A DNA vector produced by replication of the polynucleotide of any of paragraphs 33A-39A by a replication protein selected from the group consisting of AAV78, AAV52, AAV Rep68 and AAV Rep 40, where the DNA vector has a structure linear and continuous, it lacks a specific prokaryote methylation and is not encapsulated in an AAV capsid protein.
[00426] [00426] 41A. A DNA vector comprising: an expression cassette; a modified ITR upstream (5'-end) of the expression case, wherein the modified ITR comprises a polynucleotide of SEQ ID NO: 52; and a wild type ITR downstream (3'-end) of the expression cassette, wherein the wild type ITR comprises a polynucleotide of SEQ ID NO: 1, in which the DNA vector is devoid of specific methylation prokaryote and is not encapsulated in an AAV capsid protein.
[00427] [00427] 42A. The DNA vector of paragraph 41A, wherein the expression cassette comprises a cis regulatory element, wherein the cis regulatory element is selected from the group consisting of a post-transcriptional response element and a poly-A signal.
[00428] [00428] 43A. The DNA vector of paragraph 42A, wherein the post-transcriptional response element comprises a post-transcriptional response element WHP (WPRE).
[00429] [00429] 44A. The DNA vector of any one of paragraphs 42A-43A, wherein the poly-A signal comprises a poly-A BGH signal.
[00430] [00430] 45A. The DNA vector of any of paragraphs 41A-44A, wherein the expression cassette comprises a promoter selected from the group consisting of CAG promoter, AAT promoter, LP1 promoter and EF1a promoter.
[00431] [00431] 46A. The DNA vector of paragraph 41A, wherein the expression cassette comprises polynucleotides of SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9.
[00432] [00432] 47A. The DNA vector of any of paragraphs 41A-46A, wherein the expression cassette comprises an exogenous sequence.
[00433] [00433] 48A. The DNA vector of paragraph 47A, where the exogenous sequence comprises at least 2,000 nucleotides.
[00434] [00434] 49A. The DNA vector of paragraph 47A, where the exogenous sequence encodes a protein.
[00435] [00435] 50A. The DNA vector of paragraph 47A, where the exogenous sequence encodes a reporter protein.
[00436] [00436] 51A. A cell that comprises the DNA vector of any one of paragraphs 41A-50A.
[00437] [00437] 52A. The cell in paragraph 52A which further comprises a replication protein selected from the group consisting of: AAV Rep 78, AAV Rep 68, AAV Rep52 and AAV Rep 40.
[00438] [00438] 53A. The cell in paragraph 51A, wherein said replicating protein is encoded by a helper virus.
[00439] [00439] 54A. The cell of any one of paragraphs 51-53, wherein the cell lacks a gene that encodes an AAV capsid protein.
[00440] [00440] 55A. Pharmacologically active ingredient comprising: the DNA vector of any of paragraphs 1A-10A; and optionally, an excipient.
[00441] [00441] 56A. Method for delivering an exogenous sequence to a cell that comprises the step of: introducing said non-encapsulated DNA vector from any of paragraphs 1A to 10A into said cell.
[00442] [00442] 57A. The method of paragraph 16A, wherein said step of introducing the DNA vector comprises hydrodynamic injection.
[00443] [00443] 58A. Method for preparing a DNA vector that comprises the steps of: introducing into a cell a nucleic acid construct or a virus that comprises: an expression cassette; a modified ITR upstream (5'-end) of the expression case, wherein the modified ITR comprises a polynucleotide of SEQ ID NO: 52; and a wild type ITR downstream (3'-end) of the expression cassette, wherein the wild type ITR comprises a polynucleotide of SEQ ID NO: 1, wherein said cell is devoid of a cap protein AAV; and collecting said DNA vector produced from said nucleic acid construct or said virus, wherein said DNA vector is devoid of specific prokaryote methylation and is not encapsulated in an AAV capsid protein.
[00444] [00444] 59A. The method of paragraph 18A, wherein the expression cassette comprises a cis regulatory element, wherein the cis regulatory element is selected from the group consisting of a post-transcriptional response element and a poly-A signal.
[00445] [00445] 60A. The method of paragraph 59A, wherein the post-transcriptional response element comprises a post-transcriptional response element WHP (WPRE).
[00446] [00446] 61A. The method of any of paragraphs 59A-60A, wherein the poly-A signal comprises a poly-A BGH signal.
[00447] [00447] 62A. The method of any of paragraphs 18A-61A, wherein the expression cassette comprises a promoter selected from the group consisting of CAG promoter, AAT promoter, promoter
[00448] [00448] 63A. The method of paragraph 18A, wherein said expression cassette comprises polynucleotides of SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9.
[00449] [00449] 64A. The method of any of paragraphs 18A-63A, wherein the expression cassette further comprises an exogenous sequence.
[00450] [00450] 65A. The method of paragraph 23A, wherein the exogenous sequence comprises at least 2,000 nucleotides.
[00451] [00451] 66A. The method of paragraph 23A, wherein the exogenous sequence encodes a protein.
[00452] [00452] 67A. The method of paragraph 23A, wherein the exogenous sequence encodes a reporter protein.
[00453] [00453] 68A. The method of any of paragraphs 18A-26A, wherein said cell is an insect cell.
[00454] [00454] 69A. A vector of DNA generated using the method of any of paragraphs 18A-27A.
[00455] [00455] 70A. The DNA vector of paragraph 69A, where the DNA vector has a linear and continuous structure.
[00456] [00456] 71A. A cell to produce a DNA vector that comprises: a first polynucleotide that comprises: an expression cassette; a modified ITR upstream (5'-end) of the expression case, wherein the modified ITR comprises a polynucleotide of SEQ ID NO: 52; and a wild type ITR downstream (3'-end) of the expression cassette, wherein the wild type ITR comprises a polynucleotide of SEQ ID NO: 1; and a second polynucleotide encoding a replication protein selected from the group consisting of AAV78, AAV52, AAV Rep68 and AAV Rep 40, wherein said cell is devoid of a gene encoding an AAV capsid protein.
[00457] [00457] 72A. The cell in paragraph 71A, wherein said cell is an insect cell.
[00458] [00458] 73A. A DNA vector produced from the cell of any one of paragraphs 29A-50A, by replicating said first polynucleotide.
[00459] [00459] 74A. A polynucleotide to generate a DNA vector that comprises: an expression cassette; a modified ITR upstream (5'-end) of the expression case, wherein the modified ITR comprises a polynucleotide of SEQ ID NO: 52; and a wild type ITR downstream (3'-end) of the expression cassette, wherein the wild type ITR comprises a polynucleotide of SEQ ID NO: 1.
[00460] [00460] 75A. The polynucleotide in paragraph 74A, where the polynucleotide is in a plasmid, bacmid or baculo virus.
[00461] [00461] 76A. The polynucleotide of any one of paragraphs 74A-75A which further comprises an exogenous sequence.
[00462] [00462] 77A. The polynucleotide of paragraph 74A, wherein the exogenous sequence comprises at least 2,000 nucleotides.
[00463] [00463] 78A. The polynucleotide in paragraph 74A, where the exogenous sequence encodes a protein.
[00464] [00464] 79A. The polynucleotide in paragraph 74A, where the exogenous sequence encodes a reporter
[00465] [00465] 80A. A vector of DNA produced by replication of the polynu-
[00466] [00466] 81A. The DNA vector of paragraph 80A, where the DNA vector is produced in an insect cell.
[00467] [00467] 82A. A ceDNA vector obtained from a plasmid comprising a mutated AAV ITR sequence in any of Tables 2-6 or Tables 7-10A or 10B.
[00468] [00468] In some embodiments, the present application can be defined in any of the following paragraphs:
[00469] [00469] 1B. A DNA vector obtained by a process that comprises: (a) transfecting a first population of insect cells with a first recombinant bacmid, obtained by transposing a first DNA plasmid construct into a baculovirus expression vector , the first DNA plasmid construction proceeding sequentially in the following order in a single direction: the first replicative protein site (RPS-1), a promoter operatively linked to an ORF reporter polynucleotide sequence, a post signal -traditional and terminating and a second replicative protein site (RPS-2), in which RPS-1 and RPS-2 are doubly intramolecularly duplex and covalently joined, and RPS-1 has one or more deletions, substitutions or truncations of pairs of polynucleotide bases in relation to RPS-2 and then harvest a first population of insect cells injected in the staff (BIICs-1); (b) transfecting a second population of insect cells with a second recombinant bacmid, obtained by transposing a second DNA plasmid construct to a second vector.
[00470] [00470] 2B. The DNA vector of paragraph 1B, where RPS-1 and
[00471] [00471] In some modalities, this request can be defined in any of the following paragraphs:
[00472] [00472] 1C. An AAV vector without capsid (cfAAV) comprising: an expression cassette comprising a cis regulatory element, a promoter and an exogenous sequence; and two self-complementary sequences that flank the right expression cassette, in which the cfAAV vector is not associated with a capsid protein and is devoid of prokaryote-specific methylation.
[00473] [00473] 2C. The cfAAV vector of paragraph 1C, in which the cis regulation elements are selected from the group consisting of a switch, an isolator, an element adjustable by mir and a post-transcriptional regulatory element.
[00474] [00474] 3C. The cfAAV vector in any of paragraphs 1C-2C, where the DNA vector is CELiD.
[00475] [00475] 4C. The cfAAV vector of any of paragraphs 1C-3C, where the two self-complementary strings are AAV2 ITR strings.
[00476] [00476] 5C. The cfAAV vector of any of paragraphs 1C-4C, wherein the exogenous sequence comprises an internal ribosome entry site (IRES) and an element 2A.
[00477] [00477] 6C. The cfAAV vector of paragraph 5C, in which the expression cassette comprises a sequence that encodes more than one protein.
[00478] [00478] 7C. The cfAAV vector of any of paragraphs 1C-6C, wherein the expression cassette comprises more than 4,000 nucleotides, 5,000 nucleotides, 10,000 nucleotides or 20,000 nucleotides.
[00479] [00479] 8C. A pharmacological composition comprising the cfAAV vector of any of paragraphs 1C-7C.
[00480] [00480] 9C. An expression construct comprising: an expression cassette comprising a cis regulatory element, a promoter and an exogenous sequence; and two sequences of inverted terminal repetition (ITR) that flank said expression cassette, in which the expression construct is devoid of an open reading frame that encodes a capsid protein.
[00481] [00481] 10C. The expression construct of paragraph 9C, in which the cis regulation elements are selected from the group consisting of a ribocomutator, an isolator, a mir adjustable element and a post-transcriptional regulatory element.
[00482] [00482] 11C. The expression cassette of any of paragraphs 9C-10C, wherein the exogenous sequence comprises an internal ribosome entry site (IRES) and an element 2A.
[00483] [00483] 12C. The expression cassette of paragraph 11, wherein the expression cassette comprises a sequence that encodes more than one protein.
[00484] [00484] 13C. The expression construct of any of the 9C-12C paragraphs, where the expression construct is in a plasmid, a bacide or a baculovirus.
[00485] [00485] 14C. A method for generating a cfAAV vector that comprises:
[00486] [00486] 15C. The method of paragraph 14C which further comprises the step of replicating the expression construct several times before introducing the expression construct into the cell.
[00487] [00487] 16C. The method of paragraph 15C, in which the expression construct is on a plasmid and the replication step is performed on an E. coli.
[00488] [00488] 17C. The method of paragraph 16C which further comprises the step of transferring the expression construct from the plasmid to a Bacmid before introducing the expression construct into the cell.
[00489] [00489] 18C. The method of paragraph 17C which further comprises the step of transferring the Bacmid expression construct to a baculovirus before introducing the expression construct into the cell.
[00490] [00490] 19C. The method of any of paragraphs 14C-18C which further comprises the step of introducing a Rep protein into the cell.
[00491] [00491] 20C. The method of any of paragraphs 14C-19C, wherein the cell is an insect cell.
[00492] [00492] 21C. The cfAAV vector produced by the method of any of paragraphs 14C-20C.
[00493] [00493] 22C. The cfAAV vector of paragraph 21C, where the DNA vector is CELiD.
[00494] [00494] In some embodiments, the present application can be defined in any of the following paragraphs:
[00495] [00495] 1D. Non-viral DNA vector without capsid, obtained from a polynucleotide vector, in which the polynucleotide vector encodes a heterologous nucleic acid operatively positioned between a first and a second polynucleotide sequence of AAV2 inverted terminal repeat (ITRs) , in which at least one of the ITRs has at least one polynucleotide deletion, insertion or substitution in relation to the corresponding wild-type AAV2 ITR of SEQ ID NO: 1 or SEQ ID NO: 51 to induce DNA vector replication in an insect cell in the presence of the Rep protein, in which the DNA vector is obtained from a process that comprises the steps of: a. incubate a population of insect cells that harbor the vector polynucleotide, which is devoid of coding sequences for the viral capsid, in the presence of the Rep protein, under effective conditions and long enough to induce the production of non-viral DNA without capsid within insect cells, where insect cells do not comprise coding sequences for the viral capsid; and b. harvest and isolate non-viral DNA without capsid from insect cells; where the presence of non-viral DNA without capsid isolated from insect cells can be confirmed by digesting the isolated DNA from insect cells with a restriction enzyme with a single recognition site in the DNA vector and analyzing the digested material DNA in a non-denaturing gel to confirm the presence of characteristic bands of linear and continuous DNA compared to linear and non-continuous DNA.
[00496] [00496] 2D. The non-viral DNA vector without capsid, from paragraph 1, in which the mutated ITR is selected from the group consisting of: SEQ ID NO: 2 and SEQ ID NO: 52.
[00497] [00497] 3D. The non-viral DNA vector without capsid, from paragraph 1, in which the polynucleotide of the vector comprises a pair of ITRs selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO:
[00498] [00498] 4D. A non-viral DNA vector without capsid, obtained from a polynucleotide vector, in which the polynucleotide vector encodes a heterologous nucleic acid operatively positioned between two different inverted terminal repeat sequences (ITRs), in which at least one of the ITRs is a functional ITR that comprises a functional terminal resolution site and a Rep binding site, and in which one of the ITRs comprises a deletion, insertion or substitution, in relation to the functional ITR; the presence of Rep protein inducing replication of the polynucleotide vector and production of the DNA vector in an insect cell, in which the DNA vector is obtained from a process that comprises the steps of: a. incubate a population of insect cells that harbor the vector polynucleotide, which is devoid of coding sequences for the viral capsid in the presence of the Rep protein under effective conditions and long enough to induce the production of the non-viral non-capsid DNA vector within the insect cells, where the insect cells do not comprise non-viral DNA produced without capsid within the insect cells; and b. harvest and isolate non-viral DNA without capsid from insect cells; where the presence of non-viral DNA without capsid isolated from insect cells can be confirmed by digesting DNA isolated from insect cells with a restriction enzyme with a single recognition site in the DNA vector and analyzing the digested material DNA in a non-denaturing gel to confirm the presence of characteristic bands of linear and continuous DNA compared to linear and non-continuous DNA.
[00499] [00499] In some modalities, this request can be defined in any of the following paragraphs:
[00500] [00500] 1E. A vector comprising (i) a DNA vector without non-viral capsid with covalently closed ends (ceDNA vector), wherein the ceDNA vector comprises a heterologous nucleic acid sequence that encodes the transgene operably positioned between two different repeat sequences AAV inverted terminal (ITRs), one of the ITRs that comprises a functional AAV terminal resolution site and a Rep binding site, one of the ITRs that comprises a deletion, insertion or substitution in relation to the other ITR (modified ITR), where the vector is not in a viral capsid.
[00501] [00501] 2E. The ceDNA vector in paragraph 1, where the ceDNA vector when digested with a restriction enzyme that has a single recognition site in the ceDNA vector has the presence of characteristic bands of linear and continuous DNA compared to linear and non-linear controls. strands of DNA when analyzed on a non-denaturing gel.
[00502] [00502] 3E. The ceDNA vector in paragraph 1E, in which the modified ITR is of a different serotype.
[00503] [00503] 4E. The ceDNA vector in paragraph 3E, where the modified ITR is not a wild-type ITR.
[00504] [00504] 5E. The ceDNA vector of paragraph 1E, where the deletion, insertion or substitution is in at least one of the ITR regions selected from the group consisting of A, A ', B, B', C, C 'and D.
[00505] [00505] 6E. The ceDNA vector of paragraph 5E, in which the deletion, insertion or substation results in the deletion of one of the loops formed by regions A, A ', B, B' C or C '.
[00506] [00506] 7E. The ceDNA vector in paragraph 1E, where the modification corresponds to the change in an AAV2 modified ITR selected from the group consisting of SEQ ID NO: 101-498 and 499 or 545-
[00507] [00507] 8E. The ceDNA vector in paragraph 1E, where the modification corresponds to the change in an AAV2 modified ITR selected from the group consisting of SEQ ID NO: 2, 52, 63 and 64.
[00508] [00508] 9E. The ceDNA vector in paragraphs 1E-8E, where the vector is in a nanocarrier.
[00509] [00509] 10E. The ceDNA vector of paragraph 9E, in which the nanocarrier comprises a lipid nanoparticle (LNP).
[00510] [00510] 11E. A method comprising: producing a non-viral capsid DNA without covalently closed ends (ceDNA) using a vector polynucleotide, where the vector polynucleotide encodes a heterologous nucleic acid operatively positioned between two different inverted terminal repeat sequences (ITRs ), in which at least one of the ITRs comprising a functional terminal resolution site and a Rep binding site and one of the ITRs comprising a deletion, insertion or substitution in relation to the other ITR; the presence of Rep protein inducing the replication of the polynucleotide vector and production of the DNA vector in an insect cell, the DNA vector being obtained from a process that comprises the steps of: a. incubate a population of insect cells that harbor the vector polynucleotide, which is devoid of coding sequences for the viral capsid in the presence of the Rep protein under effective conditions and long enough to induce the production of the non-viral non-capsid DNA vector within the insect cells, where the insect cells do not comprise non-viral DNA produced without capsid within the insect cells; and b. harvest and isolate non-viral DNA without capsid from insect cells; in which the presence of non-viral DNA without capsid isolated from insect cells can be confirmed by digesting DNA isolated from insect cells with a restriction enzyme that has a single recognition site in the DNA vector and analyzing the digested material DNA in a non-denaturing gel to confirm the presence of characteristic bands of linear and continuous DNA compared to linear and non-continuous DNA.
[00511] [00511] 12E. Non-viral DNA vector without capsid obtained from a polynucleotide vector, in which the vector encodes a heterologous gene operationally positioned between a first and a second polynucleotide sequence of AAV2 inverted terminal repeat (ITRs) , with at least one of the ITRs having at least at least one polynucleotide deletion, insertion or substitution in relation to the corresponding wild-type ITR AAV2 of SEQ ID NO: 1 or SEQ ID NO: 51 to induce DNA vector replication in an insect cell in the presence of Rep protein, the vector DNA being obtained from a process that comprises the steps of: (a) incubating a population of insect cells that harbor the polynucleotide vector, which is devoid of coding sequences of the viral capsid, in the presence of the Rep protein, in effective conditions and for a time sufficient to induce the production of non-viral DNA within the insect cells, in which the insect cells do not comprise sequence coding areas of the viral capsid; and (b) harvesting and isolating non-viral DNA without capsid from insect cells; where the presence of non-viral DNA without capsid isolated from insect cells can be confirmed by digesting DNA isolated from insect cells with a restriction enzyme with a single recognition site in the DNA vector and analyzing the digested material DNA in a non-denaturing gel to confirm the presence of characteristic bands of linear and continuous DNA compared to linear and non-continuous DNA.
[00512] [00512] 13E. The non-viral DNA vector without capsid, from paragraph 12E, in which the modified ITR is selected from the group consisting of: SEQ ID NO: 2 and SEQ ID NO: 52.
[00513] [00513] 14E. The non-viral DNA vector without capsid, of paragraph 12E, in which the polynucleotide of the vector comprises a pair of ITRs selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO: 52; SEQ ID NO: 2 and SEQ ID NO: 51.
[00514] [00514] 15E. A non-viral DNA vector without capsid obtained from a polynucleotide vector, in which the polynucleotide vector encodes a heterologous gene positioned operationally between two different inverted terminal repeat sequences (ITRs), at least one of the ITRs that comprises a functional terminal resolution site and a Rep binding site and one of the ITRs comprising a deletion, insertion or substitution, the presence of the Rep protein inducing the replication of the vector polynucleotide and the production of the DNA vector in an insect cell, in which the DNA vector is obtained from a process that comprises the steps of: (a) incubating a population of insect cells that open the vector polynucleotide, which is devoid of sequences of coding the viral capsid in the presence of the Rep protein under effective conditions and long enough to induce the production of the non-viral DNA vector without capsid within the insect cells, in which the ins seto do not comprise non-viral capsid production DNA within insect cells; and (b) harvesting and isolating non-viral DNA without capsid from insect cells; in which the presence of non-viral DNA without capsid isolated from insect cells can be confirmed by digesting DNA isolated from insect cells with a restriction enzyme with a single recognition site in the DNA vector and analyzing the digested material DNA
[00515] [00515] 17E. A non-viral DNA vector without capsid of paragraph 15E, where an ITR is a wild-type AAV ITR.
[00516] [00516] 18E. A method for treating disease in an individual, in which the method comprises: co-administering to an individual in need, a composition comprising (i) a DNA vector without a non-viral capsid with covalently closed ends (ceD vector - NA), in which the ceDNA vector comprises a heterologous nucleic acid sequence that encodes a transgene operatively positioned between two different AAV inverted terminal repeat sequences (ITRs), one of the ITRs comprising a resolution site functional AAV terminal and a Rep binding site, one of the ITRs that comprises a deletion, insertion or substitution in relation to the other ITR.
[00517] [00517] 19E. The method of paragraph 17E, wherein the ceD-NA vector is administered in combination with a pharmaceutically acceptable carrier.
[00518] [00518] 20E. A method for administering therapy to an individual, the method comprising:
[00519] [00519] administering to an individual, a composition that comprises the ceDNA vector of paragraphs 1E-10E and 12E-16E. EXAMPLES
[00520] [00520] The following examples are provided by way of illustration, not by way of limitation. Example 1: Building ceDNA vectors
[00521] [00521] The production of ceDNA vectors using a polynucleotide construct model is described. For example, a polynucleotide construct model used to generate the ceDNA vectors of the present invention can be a ceDNA plasmid, a ceDNA-Bacmid and / or a ceDNA-baculovirus. Without being limited to theory, in a permissive host cell, in the presence of, for example, Rep, the polynucleotide construct model with two ITRs and an expression construct, in which at least one of the ITRs is modified, replicates to produce ceDNA vectors. The production of the ceD-NA vector goes through two stages: first, excision ("rescue") of the main structure model model (for example, ceDNA plasmid, ce-DNA-bacmid, ceDNA-baculovirus genome, etc.) by Rep protein medium and second Rep-mediated replication of the excised ceDNA vector.
[00522] [00522] An exemplary method for producing ceDNA vectors is of a ceDNA plasmid, as described herein. With reference to Figures 1A and 1B, the polynucleotide construct model for each of the ceDNA plasmids includes a left ITR and a right mutated ITR with the following between the ITR sequences: (i) an enhancer / promoter; (ii) a cloning site for a transgenic; (iii) a post-transcriptional response element (for example, the post-transcriptional regulatory element of the woodchuck hepatitis virus) (WPRE); and (iv) a polyadenylation signal (for example, from the bovine growth hormone gene (BGHpA)). Unique restriction endonuclease recognition sites (R1-R6) (shown in Figures 1A and 1B) have also been introduced between each component to facilitate the introduction of new genetic components at specific sites in the R3 (PmeI) construct GTTTAAAC (SEQ ID NO: 7) and R4 (PacI). The TTAATTAA enzyme sites (SEQ ID NO: 542) are designed on the cloning site to introduce an open reading frame for a transgene. These sequences were cloned into a plasmid pFastBac HT B obtained from ThermoFisher Scientific.
[00523] [00523] In summary, a series of ceDNA vectors was obtained from the plasmid constructs of ceDNA shown in Table 12, using the process shown in Figures 4A-4C. Table 12 indicates the corresponding polynucleotide sequence number for each component, including sequences active as a replication protein (RPS) site (for example, Rep-binding site) at each end of a promoter operably linked to a transgene. The numbers in Table 12 refer to the SEQ ID NO in this document, corresponding to the sequences of each component. Table 12: CeDNA exemplifying constructs. Plasmid ITR-L Promoter Transgene ITR-R Construct-1 51 3 Luciferase 2 Construct-2 52 3 Luciferase 1 Construct-3 51 4 s / SV40 intr Luciferase 2 Construct-4 52 4 s / SV40 intr Luciferase 1 Construto-5 51 5 without SV40 intr Luciferase 2 Construto-6 52 5 without SV40 intr Luciferase 1 Construto-7 51 6 Luciferase 2 Construto-8 52 6 Luciferase 1
[00524] [00524] In some embodiments, a construct for making ceDNA vectors comprises a promoter that is a regulatory switch as described herein, for example, an inducible promoter. Other constructs were used to make ceDNA vectors, for example, constructs 10, constructs 11, constructs 12 and construct 13 (see, for example, Table 14A) that comprise an MND or HLCR promoter operably linked to a transgene luciferase. Production of ceDNA-bacmids:
[00525] [00525] With reference to Figure 4A, DH10Bac competent cells (MAX EFFICIENCY® DH10Bac ™ competent cells, Thermo Fisher) were transformed with test or control plasmids, following a protocol according to the manufacturer's instructions.
[00526] [00526] The recombinant ceDNA-bacmids were isolated from E. coli and transfected into Sf9 or Sf21 insect cells using FugeenHD to produce infectious baculovirus. The corresponding Sf9 or Sf21 insect cells were cultured in 50 ml of medium in T25 flasks at 25 ° C. Four days later, the culture medium (containing the P0 virus) was removed from the cells, filtered through a 0.45 µm filter, separating the infectious baculovirus particles from the cells or cellular debris.
[00527] [00527] Optionally, the first generation of baculovirus (P0) was amplified through the infection of naive Sf9 or Sf21 insect cells in 50 to 500 mL of medium. The cells were maintained in suspension cultures in an orbital shaker incubator at 130 rpm at 25 ° C, monitoring the diameter and viability of the cells, until the cells reached a diameter of 18 to 19 nm (from a diameter naive from 14 to 15 nm) and a density of ~ 4.0E + 6 cells / mL. Between 3 and 8 days after infection, baculovirus P1 particles in the medium were collected after centrifugation to remove cells and debris and filtration through a 0.45 µm filter.
[00528] [00528] The ceDNA-baculoviruses that comprise the test products were collected and the infectious activity, or titer, of the baculovirus was determined. Specifically, four cultures of Sf9 cells x 20 mL at 2.5E + 6 cells / mL were treated with baculovirus P1 at the following dilutions: 1 / 1,000, 1 / 10,000, 1 / 50,000, 1 / 100,000 and incubated at 25 27 ° C. Infectivity was determined by the rate of increase in cell diameter and cell cycle arrest, and change in cell viability every day, for 4 to 5 days.
[00529] [00529] With reference to Figure 4A, a "Rep-plasmid" according to Figure 8A was produced in an expression vector pFAS-TBACTM-Dual (ThermoFisher) comprising Rep78 (SEQ ID NO: 13) or Rep68 (SEQ ID NO: 12) and Rep52 (SEQ ID NO: 14) or Rep40 (SEQ ID NO: 11).
[00530] [00530] The Rep-plasmid was transformed into DH10Bac competent cells (MAX EFFICIENCY® DH10Bac ™ competent cells (Thermo Fisher), following a protocol provided by the manufacturer. The recombination between the Rep plasmid and a baculovirus shuttle vector in the cells DH10Bac was induced to generate recombinant bacmids ("Rep-bacmids"). The recombinant bacmids were selected by a positive selection that included blue-white screening in E. coli (marker Φ 80dlacZ Δ M15 provides an α complement to the gene β-galactosidase from the bacmid vector) on a bacterial agar plate containing X-gal and IPTG, isolated white colonies were collected and inoculated in 10 mL of selection medium (kanamycin, gentamycin, tetracycline in broth LB) The recombinant bacmids (Rep-bacmids) were isolated from E. coli and the rep-bacmids were transfected into Sf9 or Sf21 insect cells to produce infectious baculovirus.
[00531] [00531] Sf9 or Sf21 insect cells were cultured in 50 ml of medium for 4 days and the infectious recombinant baculoviruses ("Rep-baculovirus") were isolated from the culture. Optionally, the Republic
[00532] [00532] With reference to Figure 4B, Sf9 insect cell culture media containing (1) a sample containing a ceDNA-bacmid or a ceDNA-baculovirus and (2) rep-baculovirus described above were then added to a new culture of Sf9 cells (2.5E + 6 cells / mL, 20 mL) in the proportion of 1: 1,000 and 1: 10,000, respectively. The cells were then cultured at 130 rpm at 25 ° C. 4 to 5 days after co-infection, the diameter and cell viability are detected. When the cell diameters reached 18 to 20 nm with a viability of ~ 70-80%, the cell cultures were centrifuged, the medium was removed and the cell pellets were collected. Cell pellets are first resuspended in an appropriate volume of aqueous medium, water or buffer. The ceDNA vector was isolated and purified from the cells using the Qiagen MIDI PLUS ™ purification protocol (Qiagen, 0.2 mg processed cell granule mass per column).
[00533] [00533] The yields of ceDNA vectors produced and purified from Sf9 insect cells were initially determined based on UV absorbance at 260 nm. The yields of various ceDNA vectors determined based on UV absorbance are given below in Table 13. Table 13: Yield of ceDNA vectors from exemplary constructs. Construct Volume Culture parameters Yield Estimate yield of culture (Diameter in micrometers) (mg / l) mated (pg / cell) construct-1 2x1L Total: 6.02 x10e6 15.8 5.23 Viability: 53.3% Diameter : 18.4
[00534] [00534] ceDNA vectors can be evaluated by identified by agarose gel electrophoresis in native or denaturing conditions, as illustrated in Figure 4D, in which (a) the presence of characteristic bands migrating at twice the size in gels denaturants versus native gels after restriction endonuclease cleavage and gel electrophoretic analysis and (b) the presence of monomer and dimer bands (2x) in denaturing gels for non-cleaved material is characteristic of the presence of the vector ceDNA.
[00535] [00535] The structures of the isolated ceDNA vectors were further analyzed by digesting the DNA obtained from the co-infected Sf9 cells (as described in this document) with restriction endonucleases selected for a) the presence of only a single site of cutting in the ceDNA vectors and b) resulting fragments that were large enough to be clearly seen when fractionated on a 0.8% (> 800 bp) denaturing agarose gel. As illustrated in Figure 4E, linear DNA vectors with a non-continuous structure and the ceDNA vector with a linear and continuous structure can be distinguished by the sizes of their reaction products - for example, a DNA vector with a non-continuous structure produces fragments of 1kb and 2kb, while a vector not encapsulated with the continuous structure must produce fragments of 2kb and 4kb.
[00536] [00536] Therefore, to demonstrate qualitatively that the isolated ceDNA vectors are covalently closed, as required by definition, the samples were digested with a restriction endonuclease identified in the context of the specific sequence of the DNA vector as having a single restriction site., preferably resulting in two cleavage products of unequal size (eg 1,000 bp and 2,000 bp). After digestion and electrophoresis in a denaturing gel (which separates the two complementary DNA strands), a linear and non-covalently closed DNA will be resolved in the sizes of 1,000 bp and 2,000 bp, while a covalently closed DNA (that is, a vector of ceDNA) will be resolved in 2x sizes (2,000 bp and 4,000 bp), as the two strands of DNA are linked and now unfold and are twice as long (albeit single-stranded). In addition, the digestion of the monomeric, dimeric and nomeric forms of the DNA vectors will be resolved as fragments of the same size due to the end-to-end connection of the multimeric DNA vectors (see Figure 4D).
[00537] [00537] Figure 5 provides an example image of a denaturing gel with ceDNA vectors as follows: construct-1, construct-2, construct-3, construct-4, construct-5, construct-6, construct- 7 and construct-8 (all described in Table 12 above), with (+) or without digestion (-) by endonuclease. Each ceDNA vector from constructs-1 to construct-8 produced two bands (*) after the en-donuclease reaction. Its two band sizes determined based on the size marker are provided at the bottom of the image. The sizes of the bands confirm that each of the ceDNA vectors produced from plasmids comprising construction 1 through construction 8 has a continuous structure.
[00538] [00538] As used herein, the expression "Assay for identifying DNA vectors by agarose gel electrophoresis under native gel and denaturation conditions" refers to an assay to assess the proximity of ceDNA, performing digestion with restriction endonucleases followed by electrophoretic evaluation of the digested products.
[00539] [00539] The purity of the generated ceDNA vector can be evaluated using any method known in the art. As an exemplary and non-limiting method, the contribution of the ceDNA plasmid to the total UV absorbance of a sample can be estimated by comparing the fluorescent intensity of the ceDNA vector with a standard. For example, if based on UV absorbance, 4 µg of the ceDNA vector was loaded onto the gel, and the fluorescent intensity of the ceDNA vector is equivalent to a 2kb band that is known as 1 µg, then there is 1 µg of vector of ceDNA and the ceDNA vector is 25% of the total UV absorbing material. The intensity of the band on the gel is plotted against the calculated input that the band represents - for example, if the total ceDNA vector is 8kb and the required comparative band is 2kb, the band intensity will be plotted as 25% of the input. total input, which in this case would be 0.25 µg for 1.0 µg of input. Using the plasmid titration of the ceDNA vector to plot a standard curve, a regression line equation is then used to calculate the amount of the ceDNA vector band, which can be used to determine the percentage of the total input represented by the ceDNA vector, or percentage of purity. Example 2: Production of viral DNA in ceDNA cells
[00540] [00540] The ceDNA vectors were also generated from constructs 11, 12, 13 and 14 shown in Table 14A. The ceDNA plasmids comprising constructs 11-14 were generated by molecular cloning methods well known in the art. The plasmids in Table 14A were constructed with the WPRE comprising SEQ ID NO: 8 followed by BGHpA comprising SEQ ID NO: 9 in the 3 'untranslated region between the transgene and the right ITR.
[00541] [00541] The Backbone vector for constructs of constructs 11-14 is as follows: (i) asymITR-MND-gluciferase -wPRE-BGH-polyA-ITR in pFB-HTb (construction 11), (ii) ITR-MND-luciferase –WPRE-BGH-polyA– assimITR in pFB-HTb (contract 12), (iii) asymITR – HLCR-AAT-luc-wPRE (O) -BGH-polyA-ITR in pFB-HTb (construct 13); and ITR-HLCR- AAT-luc-wPRE (O) -BGH-polyA-asymITR in pFB-HTb (construct 14), where each construct has at least one asymmetric ITR. These constructs also comprise one or more of the following sequences: wPRE0 (SEQ ID NO: 72) and BGH-PolyA sequence (SEQ ID NO: 73) or sequences of at least 85%, or at least 90% or at least 95% identity of sequence.
[00542] [00542] Next, the production of the ceDNA vector was performed according to the procedure in Figure 4A-4C, for example, (a) Generation of recombinant ceDNA-Bacmide DNA and Transfection of insect cells with ceDNA- Recombinant bacmid; (b) generation of P1 material (low titer), P2 material (high titer) and determination of virus titer by Quantitative PCR, to obtain a 5 mL product,> 1E + 7 plaque-forming or "pfu" infectious units by mL BV Stock, BV Stock COA. The isolation of the ceDNA vector was performed by coinfection of 50 mL of insect cells with BV stock for the following pairs of infections: Rep-bacmid, as described in this document and at least one of the following constructs: construct 11, construct 12 , construct 13 and construct 14 The isolation of the ceDNA vector was performed using the QIAGEN Plasmid Midi kit to obtain purified DNA material for further analysis. The Tables
[00543] [00543] Table 14C shows the amount of DNA material obtained (as detected by the detection of DO) using constructs 12 and 14 of Table 14C. The yield of the total DNA material was acceptable, compared to typical yields of about 3 mg / l of DNA material from the process in Example 1 (Table 13) above. Example 3: CeDNA vectors express the luciferase transgene in vitro
[00544] [00544] The constructs were generated by the introduction of an open reading frame that encodes the Luciferase reporter gene at the cloning site of the plasmid constructs of ceDNA: construct-1, construct-3, construct-5 and construct-7 . CeDNA-plasmids (see Table 12 above) including the Lucifera-se coding sequence are called plasmid construct 1-Luc, plasmid construct
[00545] [00545] HEK293 cells were cultured and transfected with 100 ng, 200 ng or 400 ng of plasmid constructs 1, 3, 5 and 7, using FUGENE® (Promega Corp.) as a transfection agent. The luciferase expression of each of the plasmids was determined based on the luciferase activity in each cell culture and the results are provided in Figure 6A Luciferase activity was not detected from the untreated control cells ("not treated ") or cells treated only with Fugene (" Fugene "), confirming that Luciferase activity resulted from gene expression of plasmids. As shown in Figures 6A and 6B, the Luciferase expression was detected in constructs 1 and 7. The expression of construct-7 expressed Luciferase with a dose-dependent increase in the Luciferase activity being detected.
[00546] [00546] The growth and viability of cells transfected with each of the plasmids were also determined and shown in Figures 7A and 7B. Cell growth and viability of transfected cells were not significantly different between different groups of cells treated with different constructs.
[00547] [00547] Consequently, luciferase activity measured in each group and normalized based on cell growth and viability was no different from luciferase activity without normalization. The plasmid of ceDNA with the construct 1-Luc showed the most robust expression of luciferase with or without normalization.
[00548] [00548] Thus, the data presented in Figures 6A, 6B, 7A and 7B demonstrate that construct 1, which comprises from 5 'to 3'– WT-ITR (SEQ ID NO: 51), CAG promoter (SEQ ID NO: 3), cloning site R3 / R4 (SEQ ID NO: 7), WPRE (SEQ ID NO: 8), BGHpA (SEQ ID NO: 9) and a modified ITR (SEQ ID NO: 2) are effective in product
[00549] [00549] Protein expression in vivo of a transgene from ceDNA vectors produced from constructs 1-8 described above is evaluated in mice. The ceDNA vector obtained from the plasmid construct of ceDNA 1 (as described in Table 12) was tested and demonstrated expression of the sustained and durable luciferase transgene in a mouse model after hydrodynamic injection of the ceDNA construct without liposome, redose ( on day 28) and durability (until day 42) of the exogenous firefly luciferase ceDNA. In different experiments, the luciferase expression of selected ceDNA vectors is evaluated in vivo, in which the ceDNA vectors comprise the luciferase transgene and at least one modified ITR selected from those shown in Tables 10A-10B, or an ITR comprising at least one sequence shown in Figures 26A-26B
[00550] [00550] In vivo luciferase expression: male IGS CD-1 mice aged 5 to 7 weeks (Charles River Laboratories) receive 0.35 mg / kg of ceDNA vector expressing luciferase in a volume of 1.2 ml via hydrodynamic iv administration in tail vein on day 0. Luciferase expression is assessed by IVIS imaging on days 3, 4, 7, 14, 21, 28, 31, 35 and 42. Briefly, mice are injected intraperitoneally at 150 mg / kg of luciferin substrate and the luminescence of the whole body was evaluated via IVIS® Image.
[00551] [00551] IVIS imaging is performed on day 3, day 4, day 7, day 14, day 21, day 28, day 31, day 35 and day 42, and the collected organs are photographed ex vivo after sacrifice on day 42 .
[00552] [00552] During the course of the study, the animals are weighed and monitored
[00553] [00553] Luciferase expression is assessed in liver by the MAXDISCOVERY® Luciferase ELISA assay (BIOO Scientific / PerkinElmer), qPCR for liver specimen luciferase, histopathology of liver samples and / or serum liver enzyme panel (VetScanVS2; Abaxis Preventative Care Profile Plus). Example 5: Mutant itr walk screening
[00554] [00554] Additional analyzes of the relationship of the ITR structure with the formation of ceDNA were performed. A series of mutants was built to question the impact of specific structural changes on the formation of ceDNA and on the ability to express the transgene codified in ceDNA. The construction of mutants, the assay of the formation of ceDNA and the evaluation of the expression of the ceDNA transgene in human cell culture are described in more detail below. A. Mutant ITR construct
[00555] [00555] A library of 31 plasmids with unique asymmetric ITR AAV type II mutant cassettes was manipulated in silico and subsequently evaluated in Sf9 insect cells and human embryonic kidney cells (HEK293). Each ITR cassette contained a luciferase reporter gene (LUC) or green fluorescent protein (GFP), triggered by a p10 promoter sequence for expression in insect cells and a CAG promoter sequence for expression in mammalian cells. Mutations in the ITR sequence were created in the right or left ITR region. The library contained 15 mutants on the right side
[00556] [00556] Sf9 suspension cultures were maintained in Sf900 III medium (Gibco) in ventilated 200 ml tissue culture flasks. Cultures were passed every 48 hours and cell counts and growth metrics were measured before each pass using a ViCell Counter (Beckman Coulter). The cultures were kept under shaking conditions (1 ′ ′ orbit, 130 rpm) at 27 ° C. Adherent cultures of HEK293 cells were maintained in GlutiMax DMEM (Eagle's medium modified by Dulbecco, Gibco) with 1% fetal bovine serum and 1% PenStrep in 250 ml culture flasks at 37 ° C with 5% CO2. The cultures were trypsinized and passed every 96 hours. A 1:10 dilution of a 90-100% confluent flask was used to seed each pass.
[00557] [00557] The ceDNA vectors were generated and constructed as described in Example 1 above. In summary, referring to Figure 4B, the Sf9 cells transduced with plasmid constructs were allowed to grow adherently for 24 hours under stationary conditions at 27 ° C. After 24 hours, the transfected Sf9 cells were infected with the Rep vector via insect cells infected with baculovirus (BIICs). BIICs were previously tested to characterize infectivity and were used in the final dilution of 1: 2,000. BIICs diluted 1: 100 in Sf900 insect cell medium were added to each cell well previously transfected. Vector BIICs have not been added to a subset of wells as a negative control. The plates were mixed by gently rocking on a plate shaker for 2 minutes. The cells were then cultured for another 48 hours at 27 ° C under stationary conditions. All experimental constructs and controls were tested in triplicate.
[00558] [00558] After 48 hours, the 96-well plate was removed from the incubation
[00559] [00559] To ensure that the ceDNA generated in the previous study was of the expected final structure, experiments were carried out to produce sufficient quantities of each ceDNA that could be subsequently tested for the proper structure. Briefly, Sf9 suspension cultures were transfected with DNA belonging to a single ITR mutant plasmid in the library. Cultures were seeded at 1.25x106 cells / mL in flasks of Erlenmeyer culture with limited gas exchange. DNA: lipid transfection complexes were prepared using fuGene transfection reagent according to the manufacturer's instructions. The complex mixtures were prepared and incubated in the same manner as previously described for the luciferase plate assay, with increased volumes proportional to the number of cells being transfected. As in the reporter gene assay, a 4.5: 1 ratio (volume of agent / mass DNA) was used. The simulation (transfection reagents only) and untreated growth controls were prepared in parallel with the experimental cultures. After adding reagent
[00560] [00560] The putative crude ceDNA was extracted from all vials (experimental and control) using the Qiagen Plasmid Plus Midi Purification kit (Qiagen) according to the manufacturers' "high throughput" protocol. The eluates were quantified using optical density measurements obtained from a NanoDrop OneC (ThermoFisher). The resulting ceDNA extracts were stored at 4 ° C.
[00561] [00561] The previous ceDNA extracts were run on a native agarose gel (1% agarose, 1x TAE buffer) prepared with a 1: 10,000 dilution of SYBR Safe Gel Stain (ThermoFisher Scientific), next to the DNA TrackIt 1kb Plus ladder .
[00562] [00562] All mutant samples had similar results in this experiment. Two significant ranges were visible in each sample range in the samples treated with EcoR1, migrating in the denaturing gel in the expected sizes, in sharp contrast to the undigested mutant samples, which migrated in the expected size of ~ 11,000 bp. Figure 27 shows the results for a representative sample of mutants, where two bands above the bottom are seen for each digested mutant sample, compared to the single band visible in the undigested mutant samples. Thus, the mutant samples appeared to form ceDNA correctly. C. Functional expression in human cell culture
[00563] [00563] To assess the functionality of the mutant ITR ceDNA produced by the small-scale production process, cells
[00564] [00564] All references listed and disclosed in the specification and in the Examples, including patents, patent applications, international patent applications and publications, are hereby incorporated in their entirety for reference.

权利要求:
Claims (57)
[1]
1. Non-viral DNA vector without capsid with covalently closed ends (ceDNA vector), characterized by the fact that the ceDNA vector comprises at least one heterologous nucleotide sequence operatively positioned between asymmetric inverted terminal repetitive sequences (asymmetric ITRs) , wherein at least one of the asymmetric ITRs comprises a functional terminal resolution site and a Rep.
[2]
2. ceDNA vector, according to claim 1, characterized by the fact that the ceDNA vector when digested with a restriction enzyme that has a single recognition site in the ceDNA vector and analyzed by gel electrophoresis native and denaturant exhibits characteristic bands of linear and continuous DNA compared to linear and non-continuous DNA controls.
[3]
3. ceDNA vector, according to claim 1 or 2, characterized by the fact that one or more of the asymmetric ITR sequences are from a virus selected from a parvovirus, a dependovirus and an adenoassociated virus (AAV).
[4]
4. CeDNA vector, according to claim 3, characterized by the fact that asymmetric ITRs are of different viral serotypes.
[5]
5. ceDNA vector, according to claim 4, characterized by the fact that the one or more asymmetric ITRs are from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 , AAV10, AAV11 and AAV12.
[6]
6. CeDNA vector, according to any one of claims 1 to 3, characterized by the fact that one or more of the asymmetric ITR sequences are synthetic.
[7]
7. ceDNA vector, according to any one of claims 1 to 3 and 6, characterized by the fact that one or more of the
ITRs are not a wild type ITR.
[8]
8. ceDNA vector, according to any of claims 1 to 7, characterized by the fact that one or more of the asymmetric ITRs are modified by deletion, insertion and / or substitution in at least one of the selected ITR regions of A, A ', B, B', C, C ', D and D'.
[9]
9. ceDNA vector, according to claim 8, characterized by the fact that the deletion, insertion and / or substitution results in the deletion of all or part of a stem-loop structure normally formed by regions A, A ', B, B' C or C.
[10]
10. ceDNA vector according to claim 8 or 9, characterized by the fact that one or both asymmetric ITRs are modified by a deletion, insertion and / or substitution that results in the deletion of all or part of a structure of stem-loop normally formed by regions B and B '.
[11]
11. ceDNA vector, according to any of claims 8 to 10, characterized by the fact that one or both asymmetric ITRs are modified by a deletion, insertion and / or substitution that results in the deletion of all or part of a rod-handle structure normally formed by regions C and C '.
[12]
12. ceDNA vector according to claim 10 or 11, characterized by the fact that one or both asymmetric ITRs are modified by a deletion, insertion and / or substitution resulting in the deletion of part of a stem structure - loop normally formed by regions B and B 'and / or part of a rod-loop structure normally formed by regions C and C'.
[13]
13. ceDNA vector, according to any one of claims 1 to 12, characterized by the fact that one or both asymmetric ITRs comprise a single stem-loop structure in the region that normally comprises a first stem-loop structure
loop formed by regions B and B 'and a second stem-loop structure formed by regions C and C'.
[14]
14. ceDNA vector, according to claim 13, characterized by the fact that one or both asymmetric ITRs comprise a single stem and two loops in the region that normally comprise a first stem-loop structure formed by the regions - B and B 'ions and a second stem-loop structure formed by regions C and C'.
[15]
15. ceDNA vector according to claim 13 or 14, characterized by the fact that one or both asymmetric ITRs comprise a single rod and a single loop in the region that normally comprises a first rod-loop structure formed by regions B and B 'and a second stem-loop structure formed by regions C and C'.
[16]
16. ceDNA vector, according to any one of claims 1 to 15, characterized by the fact that at least one asymmetric ITR is a modified AAV2 ITR that comprises a nucleotide sequence selected from: the ITRs in Figures 26A or 26B, SEQ ID NO: 101-499 or 545 to 547, an ITR with at least 95% sequence identity with an ITR in Figures 26A or 26B and an ITR with at least 95% sequence identity with SEQ ID NO: 101 to 499 and 545 to 547.
[17]
17. ceDNA vector according to any one of claims 1 to 16, characterized by the fact that at least one asymmetric ITR is a modified AAV2 ITR comprising a nucleotide sequence of SEQ ID NO: 2, 52, 63 or 64, or a nucleotide sequence that has at least 95% sequence identity with SEQ ID NO: 2, 52, 63 or 64.
[18]
18. ceDNA vector, according to any one of claims 1 to 16, characterized by the fact that the 5 'ITR is a wild type AAV ITR and the 3' ITR comprises a sequence selected from SEQ ID NO: 2, 64, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128,130, 132, 134, 469 to 483 and 546, and ITR sequences shown in Figure 26A and sequences that have at least 95% sequence identity with any of the previous sequences.
[19]
19. ceDNA vector, according to any one of claims 1 to 16, characterized by the fact that the 3 'ITR is a wild type AAV ITR and the 5' ITR comprises a sequence selected from SEQ ID NO: 52, 63, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 484 to 499, 545 and 547, and strings of ITR shown in Figure 26B and sequences that have at least 95% sequence identity with any of the previous sequences.
[20]
20. ceDNA vector, according to any one of claims 1 to 16, characterized by the fact that the 5 'ITR comprises a sequence selected from SEQ ID NO: 52, 63, 101, 103, 105, 107 , 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 484 to 499, 545 and 547 and ITR sequences shown in Figure 26B and sequences that are at least 95% sequence identity with any of the previous sequences; and the 3 'ITR comprises a sequence selected from SEQ ID NO: 2, 64, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128,130, 132, 134, 469 to 483 and 546, and ITR sequences shown in Figure 26A and sequences that have at least 95% sequence identity with any of the previous sequences.
[21]
21. ceDNA vector, according to claim 1, characterized by the fact that it comprises at least two asymmetric ITRs selected from: a. SEQ ID NO: 1 and SEQ ID NO: 52; and b. SEQ ID NO: 2 and SEQ ID NO: 51.
[22]
22. ceDNA vector, according to claim 1, characterized by the fact that it comprises a pair of asymmetric ITRs selected from: a. SEQ ID NO: 1 and SEQ ID NO: 52; and b. SEQ ID NO: 2 and SEQ ID NO: 51.
[23]
23. ceDNA vector, according to any one of claims 1 to 20, characterized by the fact that one or both asymmetric ITRs comprise a different sequence from SEQ ID NO: 2, 52, 63, 64, 113, 114 and 557.
[24]
24. ceDNA vector, according to any one of claims 1 to 24, characterized by the fact that all or part of the heterologous nucleotide sequence is under the control of at least one regulatory switch.
[25]
25. ceDNA vector, according to claim 24, characterized by the fact that at least one regulatory switch is selected from the regulatory switches in Table 11.
[26]
26. ceDNA vector, according to any one of claims 1 to 25, characterized by the fact that the vector is in a nanocarrier.
[27]
27. CeDNA vector according to claim 26, characterized by the fact that the nanocarrier comprises a lipid nanoparticle (LNP).
[28]
28. Non-viral DNA vector without capsid with covalently closed ends (ceDNA vector), according to any one of claims 1 to 25, characterized by the fact that the ceDNA vector being obtained from a process that comprises the steps of: a. incubate a population of insect cells that harbor a ceDNA expression construct in the presence of at least one Rep protein, in which the ceDNA expression construct encodes the ceDNA vector, under effective conditions and for a sufficient time to induce the production of the ceDNA vector in insect cells; and b. isolate the ceDNA vector from insect cells.
[29]
29. ceDNA vector, according to claim 28, characterized by the fact that the ceDNA expression construct is selected from among a ceDNA plasmid, a ceDNA bacmid and a ceDNA baculovirus.
[30]
30. ceDNA vector according to claim 28 or 29, characterized in that the insect cell expresses at least one Rep protein.
[31]
31. ceDNA vector, according to claim 30, characterized by the fact that at least one Rep protein is from a virus selected from a parvovirus, a dependovirus and an adenoassociated virus (AAV).
[32]
32. ceDNA vector according to claim 31, characterized by the fact that at least one Rep protein is from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12.
[33]
33. CeDNA expression construct, characterized by the fact that it encodes the ceDNA vector, as defined in any one of claims 1 to 25.
[34]
34. CeDNA expression construct according to claim 33, characterized by the fact that it is a ceDNA plasmid, ceDNA bacmid or ceDNA baculovirus.
[35]
35. Host cell, characterized by the fact that it comprises the ceDNA expression construct, as defined in claim 33 or 34.
[36]
36. Host cell according to claim 35, characterized by the fact that it expresses at least one protein
Rep.
[37]
37. Host cell according to claim 36, characterized by the fact that at least one Rep protein is from a virus selected from a parvovirus, a dependovirus and an adenoassociated virus (AAV).
[38]
38. Host cell according to claim 37, characterized by the fact that at least one Rep protein is from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12.
[39]
39. Host cell according to any one of claims 35 to 38, characterized by the fact that it is an insect cell.
[40]
40. Host cell according to claim 39, characterized by the fact that it is an Sf9 cell.
[41]
41. Method for producing a ceDNA vector, characterized by the fact that it comprises: a. incubating the host cell, as defined in any one of claims 35 to 40, under effective conditions and for sufficient time to induce the production of the ceDNA vector; and b. isolate ceDNA from host cells.
[42]
42. Method for treating, preventing, improving, monitoring or diagnosing a disease or disorder in an individual, characterized by the fact that the method comprises: administering to an individual in need of it, a composition comprising the ceDNA vector as defined in any one of claims 1 to 25, wherein at least one heterologous nucleotide sequence is selected to treat, prevent, improve, diagnose or monitor the disease or disorder.
[43]
43. The method of claim 42, characterized by the fact that at least one nucleotide sequence
Therapist, when transcribed or translated, corrects an abnormal amount of an endogenous protein in the individual.
[44]
44. Method according to claim 42, characterized by the fact that at least one heterologous nucleotide sequence, when transcribed or translated, corrects an abnormal function or activity of an endogenous protein or pathway in the individual .
[45]
45. Method according to any of claims 42 to 44, characterized by the fact that at least one heterologous nucleotide sequence encodes or comprises a nucleotide molecule selected from an RNAi, a siRNA, a miR - NA, an lncRNA and an antisense oligo or polynucleotide.
[46]
46. Method according to any one of claims 42 to 44, characterized in that the at least one heterologous nucleotide sequence encodes a protein.
[47]
47. Method according to claim 42, characterized by the fact that at least one heterologous nucleotide sequence encodes a marker protein.
[48]
48. Method according to any one of claims 42 to 46, characterized by the fact that at least one heterologous nucleotide sequence encodes an agonist or an antagonist of a protein or endogenous pathway associated with the disease or disturb.
[49]
49. Method according to any of claims 42 to 46, characterized in that the at least one heterologous nucleotide sequence encodes an antibody.
[50]
50. Method according to any one of claims 42 to 49, characterized in that the ceDNA vector is administered in combination with a pharmaceutically acceptable carrier.
[51]
51. Method for delivering a therapeutic protein to an individual, characterized by the fact that the method comprises: administering to an individual a composition comprising the ceDNA vector, as defined in any of claims 1 to 25, in that at least one heterologous nucleotide sequence encodes a therapeutic protein.
[52]
52. Method according to claim 51, characterized by the fact that the therapeutic protein is a therapeutic antibody.
[53]
53. Kit, characterized by the fact that it comprises a ceDNA vector, as defined in any of claims 1 to 25, and a nanocarrier, packaged in a container with an information leaflet.
[54]
54. Kit to produce a ceDNA vector, characterized by the fact that the kit comprises: a. an expression construct comprising at least one restriction site for insertion of at least one heterologous nucleotide sequence, or regulatory switch, or both, at least one restriction site operationally positioned between asymmetric inverted terminal repeat sequences ( Asymmetric ITRs), in which at least one of the asymmetric ITRs comprises a functional terminal resolution site and a Rep.
[55]
55. Kit according to claim 54, characterized by the fact that it is suitable for the production of the ceDNA vector, as defined in any one of claims 1 to 25.
[56]
56. Kit according to claim 54 or 55, characterized by the fact that it also comprises a population of insect cells that is devoid of viral capsid coding sequences, which in the presence of the Rep protein can induce the production of the ceDNA vector.
[57]
57. Kit according to any one of claims 54 to 56, characterized in that it further comprises a vector comprising a polynucleotide sequence encoding at least one Rep protein, wherein the vector is suitable for expressing at least one protein Rep in an insect cell.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US20200283794A1|2020-09-10|Modified closed-ended dna |

---

BR112020009858A2|2020-11-17|gene editing with the use of a modified dna with closed ends |

---

BR112020017060A2|2020-12-15|CONTROLLED EXPRESSION OF TRANSGENES USING CLOSED END DNA VECTORS |

---

US20210071197A1|2021-03-11|Closed-ended dna vectors obtainable from cell-free synthesis and process for obtaining cedna vectors

---

CA3131130A1|2020-09-10|Non-active lipid nanoparticles with non-viral, capsid free dna

---

CA3147414A1|2021-01-21|Synthetic production of single-stranded adeno associated viral dna vectors

---

US20210388379A1|2021-12-16|Modified closed-ended dna | comprising symmetrical modified inverted terminal repeats

---

CN113454232A|2021-09-28|Modulation of REP protein activity in closed end dna | production

---

CN113874513A|2021-12-31|Non-viral DNA vectors and their use for expressing FVIII therapeutics

---

CN113874508A|2021-12-31|Non-viral DNA vectors and their use for expressing phenylalanine hydroxylase | therapeutics

---

CA3146966A1|2021-01-21|Compositions and production of nicked closed-ended dna vectors

---

WO2021195218A1|2021-09-30|Non-viral dna vectors and uses thereof for expressing gaucher therapeutics

同族专利:

---

公开号 | 公开日

---

CN111132699A|2020-05-08|

---

EP3678710A1|2020-07-15|

---

AU2018327348A1|2020-02-20|

---

SG11202000698SA|2020-03-30|

---

PH12020500465A1|2021-01-25|

---

IL272797D0|2020-04-30|

---

US20200283794A1|2020-09-10|

---

WO2019051255A1|2019-03-14|

---

RU2020109904A|2021-10-08|

---

CA3075168A1|2019-03-14|

---

MA50100A|2020-07-15|

---

EP3678710A4|2021-06-09|

---

JP2020532981A|2020-11-19|

---

KR20200051011A|2020-05-12|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

EP2500434A1|2011-03-12|2012-09-19|Association Institut de Myologie|Capsid-free AAV vectors, compositions, and methods for vector production and gene delivery|

---

JP2019501661A|2016-01-15|2019-01-24|アメリカン ジーン テクノロジーズ インターナショナル インコーポレイテッド|Methods and compositions for activation of gamma delta T cells|

---

WO2017152149A1|2016-03-03|2017-09-08|University Of Massachusetts|Closed-ended linear duplex dna for non-viral gene transfer|US10704021B2|2012-03-15|2020-07-07|Flodesign Sonics, Inc.|Acoustic perfusion devices|

---

US9725710B2|2014-01-08|2017-08-08|Flodesign Sonics, Inc.|Acoustophoresis device with dual acoustophoretic chamber|

---

EP3720952A4|2017-12-06|2021-09-01|Generation Bio Co.|Gene editing using a modified closed-ended dna |

---

KR20200089334A|2017-12-14|2020-07-24|프로디자인 소닉스, 인크.|Acoustic transducer driver and controller|

---

BR112020016288A2|2018-02-14|2020-12-15|Generation Bio Co.|NON-VIRAL DNA VECTORS AND USES OF THE SAME FOR PRODUCTION OF ANTIBODIES AND FUSION PROTEINS|

---

GB201905651D0|2019-04-24|2019-06-05|Lightbio Ltd|Nucleic acid constructs and methods for their manufacture|

---

WO2021011840A1|2019-07-17|2021-01-21|Generation Bio Co.|Compositions and production of nicked closed-ended dna vectors|

---

AU2020315444A1|2019-07-17|2021-12-23|Generation Bio Co.|Synthetic production of single-stranded adeno associated viral DNA vectors|

---

WO2021046265A1|2019-09-06|2021-03-11|Generation Bio Co.|Lipid nanoparticle compositions comprising closed-ended dna and cleavable lipids and methods of use thereof|

---

TW202124722A|2019-09-18|2021-07-01|美商英特佳樂帝克醫療公司|Synthetic dna vectors and methods of use|

---

WO2021072031A1|2019-10-11|2021-04-15|Insideoutbio, Inc.|Methods and compositions for the manufacture and use of circular dna encoded therapeutics for genetic disorders and other diseases|

---

WO2021169167A1|2020-02-29|2021-09-02|Nanjing GenScript Biotech Co., Ltd.|Method for treating coronavirus infections|

---

WO2022046665A1|2020-08-23|2022-03-03|Bioverativ Therapeutics Inc.|MODIFIED BACULOVIRUS SYSTEM FOR IMPROVED PRODUCTION OF CLOSED-ENDED DNA |

法律状态:
2021-11-23| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201762556335P| true| 2017-09-08|2017-09-08|

---

US201762556329P| true| 2017-09-08|2017-09-08|

---

US201762556281P| true| 2017-09-08|2017-09-08|

---

US201762556324P| true| 2017-09-08|2017-09-08|

---

US201762556319P| true| 2017-09-08|2017-09-08|

---

US201762556331P| true| 2017-09-08|2017-09-08|

---

US62/556,335|2017-09-08|

---

US62/556,324|2017-09-08|

---

US62/556,281|2017-09-08|

---

US62/556,331|2017-09-08|

---

US62/556,329|2017-09-08|

---

US62/556,319|2017-09-08|

---

PCT/US2018/049996|WO2019051255A1|2017-09-08|2018-09-07|Modified closed-ended dna |

---